Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU050671

Sigma-Aldrich

MISSION® esiRNA

targeting human HEMGN

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ATCCAGCAGAACCAGAGGAATACAATGAAACAGATCAAGGAATAGCTGAGACAGAAGGCCTTTTTCCTAAAATACAAGAAATAGCTGAGCCTAAAGACCTTTCTACAAAAACACACCAAGAATCAGCTGAACCTAAATACCTTCCTCATAAAACATGTAACGAAATTATTGTGCCTAAAGCCCCCTCTCATAAAACAATCCAAGAAACACCTCATTCTGAAGACTATTCAATTGAAATAAACCAAGAAACTCCTGGGTCTGAAAAATATTCACCTGAAACGTATCAAGAAATACCTGGGCTTGAAGAATATTCACCTGAAATATACCAAGAAACATCCCAGCTTGAAGAATATTCACCTGAAATATACCAAGAAACACCGGGGCCTGAAGACCTCTCTACTGAGACATATAAAAATAAGGATGTGCCTAAAGAATGCTTTCCAGAACCACACC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Zongyu Li et al.
Life sciences, 264, 118622-118622 (2020-11-19)
In the present study, we aimed to uncover the potential functions of circular RNA (circRNA) pleckstrin and Sec7 domain containing 3 (circ_PSD3) in papillary thyroid carcinoma (PTC) development. The abundance of circ_PSD3, PSD3 messenger RNA (mRNA), microRNA-637 (miR-637) and hemogen
Wei-Wei Zheng et al.
Stem cells (Dayton, Ohio), 32(8), 2278-2289 (2014-04-18)
Erythroid differentiation-associated gene (EDAG) has been considered to be a transcriptional regulator that controls hematopoietic cell differentiation, proliferation, and apoptosis. The role of EDAG in erythroid differentiation of primary erythroid progenitor cells and in vivo remains unknown. In this study

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico