Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos

EHU050421

Sigma-Aldrich

MISSION® esiRNA

targeting human DPYSL2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACGAGCGATCGTCTTCTGATCAAAGGAGGTAAAATTGTTAATGATGACCAGTCGTTCTATGCAGACATATACATGGAAGATGGGTTGATCAAGCAAATAGGAGAAAATCTGATTGTGCCAGGAGGAGTGAAGACCATCGAGGCCCACTCCCGGATGGTGATCCCCGGAGGAATTGACGTCCACACTCGTTTCCAGATGCCTGATCAGGGAATGACGTCTGCTGATGATTTCTTCCAAGGAACCAAGGCGGCCCTGGCTGGGGGAACCACTATGATCATTGACCACGTTGTTCCTGAGCCTGGGACAAGCCTGCTCGCTGCCTTTGACCAGTGGAGGGAATGGGCCGACAGCAAGTCCTGCTGTGACTACTCTCTGCATGTGGACATCAGTGAGTGGCATAAGGGCATCCAGGAGGAGATGGAAGCGCTTGTGAAGGATCACGGGGTAAATTCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hervé Husson et al.
Human molecular genetics, 25(11), 2245-2255 (2016-10-30)
Polycystic kidney diseases (PKDs) comprise a subgroup of ciliopathies characterized by the formation of fluid-filled kidney cysts and progression to end-stage renal disease. A mechanistic understanding of cystogenesis is crucial for the development of viable therapeutic options. Here, we identify
Lokesh Agrawal et al.
Neuropharmacology, 158, 107712-107712 (2019-07-22)
Serotonin (5-HT) homeostasis is critical for the brain development which influences neurogenesis, neuronal migration, and circuit formation. Distinctive distribution patterns of serotonin receptors (5-HTRs) in the brain govern various physiological activities. Amongst the 5-HTRs, serotonin 4 receptor (5-HT4R) is widely
Eun J Na et al.
Frontiers in molecular neuroscience, 10, 288-288 (2017-10-03)
Collapsin response mediator protein (CRMP)-2 and the mammalian target of rapamycin complex 1 (mTORC1) signaling pathway are associated with common physiological functions such as neuronal polarity, axonal outgrowth and synaptic strength, as well as various brain disorders including epilepsy. But
Laura Duciel et al.
Scientific reports, 9(1), 2990-2990 (2019-03-01)
Uveal melanoma (UM) is an aggressive tumor in which approximately 50% of patients develop metastasis. Expression of the PTP4A3 gene, encoding a phosphatase, is predictive of poor patient survival. PTP4A3 expression in UM cells increases their migration in vitro and

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico