Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU050111

Sigma-Aldrich

MISSION® esiRNA

targeting human PBK

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGACCCTGAGGCTTGTTACATTGGCACAGAGCCATGGAAACCCAAAGAAGCTGTGGAGGAGAATGGTGTTATTACTGACAAGGCAGACATATTTGCCTTTGGCCTTACTTTGTGGGAAATGATGACTTTATCGATTCCACACATTAATCTTTCAAATGATGATGATGATGAAGATAAAACTTTTGATGAAAGTGATTTTGATGATGAAGCATACTATGCAGCGTTGGGAACTAGGCCACCTATTAATATGGAAGAACTGGATGAATCATACCAGAAAGTAATTGAACTCTTCTCTGTATGCACTAATGAAGACCCTAAAGATCGTCCTTCTGCTGCACACATTGTTGAAGCTCTGGAAACAGATGTCTAGTGATCATCTCAGCTGAAGTGTGGCTTGCGTAA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

D Herrero-Martín et al.
British journal of cancer, 101(1), 80-90 (2009-06-06)
Ewing sarcoma is a paradigm of solid tumour -bearing chromosomal translocations resulting in fusion proteins that act as deregulated transcription factors. Ewing sarcoma translocations fuse the EWS gene with an ETS transcription factor, mainly FLI1. Most of the EWS-FLI1 target
Jia-Hong Chen et al.
International journal of biological macromolecules, 81, 615-623 (2015-09-01)
Roles and mechanisms of cell cycle-specific transcription factor E2F1 on prostate cancer (PCa) have not been fully elucidated. To address this problem, we here identified PDZ-binding kinase (PBK) as a direct target for E2F1 through bioinformatics binding site prediction, combined
Young-Ju Lee et al.
Biochemical and biophysical research communications, 522(1), 270-277 (2019-11-24)
TOPK has been suggested to contribute to invasion of lung, prostate, gastric, pancreatic or breast cancer cells. However, how TOPK mediates TGF-β1/Smad signaling leading to epithelial-mesenchymal transition (EMT) and invasion of breast cancer cells remains unknown. Here we report that
Joshua D Brown-Clay et al.
Oncotarget, 6(17), 15594-15609 (2015-04-25)
A current challenge in prostate cancer treatment is how to differentiate aggressive disease from indolent prostate cancer. There is an urgent need to identify markers that would accurately distinguish indolent prostate cancer from aggressive disease. The aim of this study
Young-Ju Lee et al.
Biochemical and biophysical research communications, 530(1), 122-129 (2020-08-24)
TGF-β1 is known to induce epithelial-mesenchymal transition (EMT), which is a prerequisite for cancer cell invasion. Here we reveal that TOPK upregulates EMT and invasion of human breast cancer MDA-MB-231 or Hs578T cells via NF-κB-dependent Snail/Slug in TGF-β1 signaling. Endogenous

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico