Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EHU049181

Sigma-Aldrich

MISSION® esiRNA

targeting human ZHX1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCAAACCAGACCGTGAAGAAATTGTAGAAAATCCAAGTTCTTCAGCTTCTGAATCTAATACAAGTACTTCCATTGTAAACAGAATACATCCAAGTACTGCCAGCACGGTAGTGACACCAGCAGCAGTTCTTCCTGGATTGGCACAGGTGATAACTGCTGTATCTGCTCAGCAGAATTCTAATTTGATTCCCAAAGTCTTAATCCCTGTTAATAGCATTCCCACCTACAATGCTGCATTGGATAACAATCCCCTTTTACTTAACACCTACAACAAGTTCCCTTACCCAACAATGTCAGAAATTACAGTTCTTTCTGCTCAAGCAAAATATACAGAGGAACAGATCAAGATATGGTTTTCAGCCCAACGTTTAAAACATGGTGTTAGTTGGACTCCCGAGGAAGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ryuk-Jun Kwon et al.
PloS one, 11(11), e0165516-e0165516 (2016-11-12)
Zinc-fingers and homeoboxes 1 (ZHX1) is a transcription repressor that has been associated with the progressions of hepatocellular carcinoma, gastric cancer, and breast cancer. However, the functional roles of ZHX1 in cholangiocarcinoma (CCA) have not been determined. We investigated the
Yi-Kai Pan et al.
Apoptosis : an international journal on programmed cell death, 25(1-2), 73-91 (2019-11-27)
Weightlessness-induced cardiovascular dysfunction can lead to physiological and pathological consequences. It has been shown that spaceflight or simulated microgravity can alter expression profiles of some microRNAs (miRNAs). Here, we attempt to identify the role of miRNAs in human umbilical vein
Jinping Guan et al.
American journal of translational research, 9(5), 2457-2465 (2017-06-01)
MicroRNAs play an important role in cell proliferation, apoptosis, differentiation, and invasion by regulating the expression of various genes. For example, the downregulation of microRNA-199a-3p (miR-199a-3p) that is noted in numerous human malignancies, including hepatocellular carcinoma (HCC), results in a

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico