Todas las fotos(1)

Documentos clave

Certificado de origen (COO)/COA

EHU046551

MISSION^® esiRNA

Name: MISSION<SUP>®</SUP> esiRNA
Brand: SIGMA

targeting human PRNP

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Todas las fotos(1)

About This Item

Código UNSPSC:

41105324

NACRES:

NA.51

descripción

Nivel de calidad

100

Línea del producto

MISSION^®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACAACTTTGTGCACGACTGCGTCAATATCACAATCAAGCAGCACACGGTCACCACAACCACCAAGGGGGAGAACTTCACCGAGACCGACGTTAAGATGATGGAGCGCGTGGTTGAGCAGATGTGTATCACCCAGTACGAGAGGGAATCTCAGGCCTATTACCAGAGAGGATCGAGCATGGTCCTCTTCTCCTCTCCACCTGTGATCCTCCTGATCTCTTTCCTCATCTTCCTGATAGTGGGATGAGGAAGGTCTTCCTGTTTTCACCATCTTTCTAATCTTTTTCCAGCTTGAGGGAGGCGGTATCCACCTGCAGCCCTTTTAGTGGTGGTGTCTCACTCTTTCTTCTCTCTTTGTCCCGGATAGGCTAATCAATACCCTTGGCACTGATGGGCACTGGAAAAC

Ensembl | nº de acceso humano

ENSG00000171867

Nº de acceso NCBI

NM_183079

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... PRNP(5621) , PRNP(5621)

Categorías relacionadas

MISSION® esiRNA

Descripción general

MISSION^® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hypoxia-induced expression of cellular prion protein improves the therapeutic potential of mesenchymal stem cells.

Yong-Seok Han et al.

Cell death & disease, 7(10), e2395-e2395 (2016-10-07)

Mesenchymal stem cells (MSCs) are 'adult' multipotent cells that promote regeneration of injured tissues in vivo. However, differences in oxygenation levels between normoxic culture conditions (21% oxygen) and both the MSC niche (2-8% oxygen) and ischemic injury-induced oxidative stress conditions

Induction of cellular prion protein (PrPc) under hypoxia inhibits apoptosis caused by TRAIL treatment.

Jin-Young Park et al.

Oncotarget, 6(7), 5342-5353 (2015-03-07)

Hypoxia decreases cytotoxic responses to tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) protein. Cellular prion protein (PrPc) is regulated by HIF-1α in neurons. We hypothesized that PrPc is involved in hypoxia-mediated resistance to TRAIL-induced apoptosis. We found that hypoxia induced PrPc

PrPC knockdown by liposome-siRNA-peptide complexes (LSPCs) prolongs survival and normal behavior of prion-infected mice immunotolerant to treatment.

Heather Bender et al.

PloS one, 14(7), e0219995-e0219995 (2019-07-23)

Prion diseases are members of neurodegenerative protein misfolding diseases (NPMDs) that include Alzheimer's, Parkinson's and Huntington diseases, amyotrophic lateral sclerosis, tauopathies, traumatic brain injuries, and chronic traumatic encephalopathies. No known therapeutics extend survival or improve quality of life of humans

Cellular and Molecular Mechanisms Mediated by recPrPC Involved in the Neuronal Differentiation Process of Mesenchymal Stem Cells.

Stefano Martellucci et al.

International journal of molecular sciences, 20(2) (2019-01-19)

Human Dental Pulp Stem Cells (hDPSCs) represent a type of adult mesenchymal stem cells that have the ability to differentiate in vitro in several lineages such as odontoblasts, osteoblasts, chondrocytes, adipocytes and neurons. In the current work, we used hDPSCs

Role of FOXC1 in regulating APSCs self-renewal via STI-1/PrPC signaling.

Yi-Hui Lee et al.

Theranostics, 9(22), 6443-6465 (2019-10-08)

Forkhead box protein C1 (FOXC1) is known to regulate developmental processes in the skull and brain. Methods: The unique multipotent arachnoid-pia stem cells (APSCs) isolated from human and mouse arachnoid-pia membranes of meninges were grown as 3D spheres and displayed

Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico