Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU044761

Sigma-Aldrich

MISSION® esiRNA

targeting human ST6GAL1 (2)

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ATGACGCAGTCCTGAGGTTTAATGGGGCACCCACAGCCAACTTCCAACAAGATGTGGGCACAAAAACTACCATTCGCCTGATGAACTCTCAGTTGGTTACCACAGAGAAGCGCTTCCTCAAAGACAGTTTGTACAATGAAGGAATCCTAATTGTATGGGACCCATCTGTATACCACTCAGATATCCCAAAGTGGTACCAGAATCCGGATTATAATTTCTTTAACAACTACAAGACTTATCGTAAGCTGCACCCCAATCAGCCCTTTTACATCCTCAAGCCCCAGATGCCTTGGGAGCTATGGGACATTCTTCAAGAAATCTCCCCAGAAGAGATTCAGCCAAACCCCCCATCCTCTGGGATGCTTGGTATCATCATCATGATGACGCTGTGTGACCAGGTGGATA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jun Zhang et al.
Biochemical and biophysical research communications, 500(2), 249-255 (2018-04-15)
Monocyte transendothelial migration is a critical step in the initial stage of atherosclerosis, in which the involvement of α-2,6 sialyltransferase 1 (ST6GAL1) has been confirmed by increasing evidence. But the direct relationship between ST6GAL1 and atherosclerosis remains incompletely uncertain. In
Yu-Chieh Wang et al.
Scientific reports, 5, 13317-13317 (2015-08-26)
Many studies have suggested the significance of glycosyltransferase-mediated macromolecule glycosylation in the regulation of pluripotent states in human pluripotent stem cells (hPSCs). Here, we observed that the sialyltransferase ST6GAL1 was preferentially expressed in undifferentiated hPSCs compared to non-pluripotent cells. A

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico