Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU041201

Sigma-Aldrich

MISSION® esiRNA

targeting human GPT2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCTGGGGTCCTACAGTGCTAGCCAGGGTGTCAACTGCATCCGTGAAGATGTGGCTGCCTACATCACCAGGAGGGATGGCGGTGTGCCTGCGGACCCCGACAACATCTACCTGACCACGGGAGCTAGTGACGGCATTTCTACGATCCTGAAGATCCTCGTCTCCGGGGGCGGCAAGTCACGGACAGGTGTGATGATCCCCATCCCACAATATCCCCTCTATTCAGCTGTCATCTCTGAGCTCGACGCCATCCAGGTGAATTACTACCTGGACGAGGAGAACTGCTGGGCGCTGAATGTGAATGAGCTCCGGCGGGCGGTGCAGGAGGCCAAAGACCACTGTGATCCTAAGGTGCTCTGCATAATCAACCCTGGGAACCCCACAGGCCAGGTACAAAGCAGAAAGTGCATAGAAGATGTGATCCACTTTGCCTGGGAAGAGAAGCTCTTTCTCCTGGCTGATGAGG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ilaria Elia et al.
Nature, 568(7750), 117-121 (2019-03-01)
The extracellular matrix is a major component of the local environment-that is, the niche-that determines cell behaviour1. During metastatic growth, cancer cells shape the extracellular matrix of the metastatic niche by hydroxylating collagen to promote their own metastatic growth2,3. However
Boris Ratnikov et al.
Oncotarget, 6(10), 7379-7389 (2015-03-10)
Glutamine dependence is a prominent feature of cancer metabolism, and here we show that melanoma cells, irrespective of their oncogenic background, depend on glutamine for growth. A quantitative audit of how carbon from glutamine is used showed that TCA-cycle-derived glutamate

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico