Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU039711

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC1A1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTTGGTTCGAGAACACAGCAACCTCTCAACTCTAGAGAAATTCTACTTTGCTTTTCCTGGAGAAATTCTAATGCGGATGCTGAAACTCATCATTTTGCCATTAATTATATCCAGCATGATTACAGGTGTTGCTGCACTGGATTCCAACGTATCCGGAAAAATTGGTCTGCGCGCTGTCGTGTATTATTTCTGTACCACTCTCATTGCTGTTATTCTAGGTATTGTGCTGGTGGTGAGCATCAAGCCTGGTGTCACCCAGAAAGTGGGTGAAATTGCGAGGACAGGCAGCACCCCTGAAGTCAGTACGGTGGATGCCATGTTAGATCTCATCAGGAATATGTTCCCTGAGAATCTTGTCCAGGCCTGTTTTCAGCAGTACAAAACTAAGCGTGAAGAAGTGAAGCCTCC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Parisa Afshari et al.
PloS one, 12(9), e0183854-e0183854 (2017-09-09)
We previously reported a 84-Kb hemi-deletion copy number variant at the SLC1A1 gene locus that reduces its expression and appeared causally linked to schizophrenia. In this report, we characterize the in vivo and in vitro consequences of reduced expression of
Silvia Piccirillo et al.
Cell death & disease, 9(7), 731-731 (2018-06-30)
In brain ischemia, reduction in oxygen and substrates affects mitochondrial respiratory chain and aerobic metabolism, culminating in ATP production impairment, ionic imbalance, and cell death. The restoration of blood flow and reoxygenation are frequently associated with exacerbation of tissue injury

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico