Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU039121

Sigma-Aldrich

MISSION® esiRNA

targeting human CD5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
$220.00
50 μG
$391.00

$220.00


Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).


Seleccione un Tamaño

Cambiar Vistas
20 μG
$220.00
50 μG
$391.00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

$220.00


Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGTTTGTCACATGCCAGGATCCAAACCCCGCAGGCCTGGCCGCAGGCACGGTGGCAAGCATCATCCTGGCCCTGGTGCTCCTGGTGGTGCTGCTGGTCGTGTGCGGCCCCCTTGCCTACAAGAAGCTAGTGAAGAAATTCCGCCAGAAGAAGCAGCGCCAGTGGATTGGCCCAACGGGAATGAACCAAAACATGTCTTTCCATCGCAACCACACGGCAACCGTCCGATCCCATGCTGAGAACCCCACAGCCTCCCACGTGGATAACGAATACAGCCAACCTCCCAGGAACTCCCACCTGTCAGCTTATCCAGCTCTGGAAGGGGCTCTGCATCGCTCCTCCATGCAGCCTGACAACTCCTCCGACAGTGACTATGATCTGCATGGGGCTCAGAGGCTGTAAAGAACTGGGATCCATGAGCAAAAAGCCGAGAGCCAGACCTGTTTGTCCTGAGAAAACTGTCCGCTC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CD5(921) , CD5(921)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Uri Rozovski et al.
Molecular cancer research : MCR, 15(5), 610-618 (2017-01-29)
In chronic lymphocytic leukemia (CLL), STAT3 is constitutively phosphorylated on serine 727 and plays a role in the pathobiology of CLL. However, what induces constitutive phosphorylation of STAT3 is currently unknown. Mass spectrometry was used to identify casein kinase 2
Anne Marie Thompson et al.
American journal of physiology. Heart and circulatory physiology, 307(4), H533-H541 (2014-06-29)
Loss of vascular smooth muscle cell (VSMC) function is a hallmark of vascular disease. VSMCs become increasingly dysregulated, apoptotic, and senescent as we age. Sirtuin 1 (SirT1) is a deactylase that regulates substrates associated with stress mitigation, metabolism, and aging.

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico