Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU038941

Sigma-Aldrich

MISSION® esiRNA

targeting human BMP7

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGGCTACGCCGCCTACTACTGTGAGGGGGAGTGTGCCTTCCCTCTGAACTCCTACATGAACGCCACCAACCACGCCATCGTGCAGACGCTGGTCCACTTCATCAACCCGGAAACGGTGCCCAAGCCCTGCTGTGCGCCCACGCAGCTCAATGCCATCTCCGTCCTCTACTTCGATGACAGCTCCAACGTCATCCTGAAGAAATACAGAAACATGGTGGTCCGGGCCTGTGGCTGCCACTAGCTCCTCCGAGAATTCAGACCCTTTGGGGCCAAGTTTTTCTGGATCCTCCATTGCTCGCCTTGGCCAGGAACCAGCAGACCAACTGCCTTTTGTGAGACCTTCCCCTCCCTATCCCCAACTTTAAAGGTGTGAGAGTATTAGGAAACATGAGCAGCATATGGCTTTTG

Ensembl | nº de acceso humano

ENSG00000101144

Nº de acceso NCBI

NM_001719

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... BMP7(655) , BMP7(655)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiaojun Ji et al.
Biological & pharmaceutical bulletin, 43(3), 533-539 (2020-03-03)
Renal interstitial fibrosis (RIF) is a common pathological characteristic associated with end-stage renal disease. However, treatment strategies for RIF are still very limited. In this study, we reported that kaempferol, a classic flavonoid, exhibited strong and widely inhibitory effect on
Maria Angelica Cortez et al.
Nature communications, 11(1), 4840-4840 (2020-09-26)
Immunotherapies revolutionized cancer treatment by harnessing the immune system to target cancer cells. However, most patients are resistant to immunotherapies and the mechanisms underlying this resistant is still poorly understood. Here, we report that overexpression of BMP7, a member of
Caixia Yuan et al.
Experimental and therapeutic medicine, 17(4), 2547-2556 (2019-03-25)
Bone morphogenetic protein (BMP) expression has been observed in the uterus in previous studies. However, the influence of BMP7 on blastocyst implantation remains unclear. Blastocysts first act on luminal endometrial epithelial cells during implantation. The purpose of the present study

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico