Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos

EHU037121

Sigma-Aldrich

MISSION® esiRNA

targeting human CA9

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CACTCCTGCCCTCTGACTTCAGCCGCTACTTCCAATATGAGGGGTCTCTGACTACACCGCCCTGTGCCCAGGGTGTCATCTGGACTGTGTTTAACCAGACAGTGATGCTGAGTGCTAAGCAGCTCCACACCCTCTCTGACACCCTGTGGGGACCTGGTGACTCTCGGCTACAGCTGAACTTCCGAGCGACGCAGCCTTTGAATGGGCGAGTGATTGAGGCCTCCTTCCCTGCTGGAGTGGACAGCAGTCCTCGGGCTGCTGAGCCAGTCCAGCTGAATTCCTGCCTGGCTGCTGGTGACATCCTAGCCCTGGTTTTTGGCCTCCTTTTTGCTGTCACCAGCGTCGCGTTCCTTGTGCAGATGAGAAGGCAGCACAGAAGGGGAACCAAAGGGGGTGTGAGCTACCGCCCAGCAGAGGTAGCCGAGACTGGAGCCTAGAGGCTGGATCTTGGAGAATGTGAGAAGCCAGC

Ensembl | human accession no.

ENSG00000107159

NCBI accession no.

NM_001216

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CA9(768) , CA9(768)

Categorías relacionadas

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Martin Benej et al.
Frontiers in oncology, 10, 1462-1462 (2020-09-29)
Tumor hypoxia represents a severe microenvironmental stress that is frequently associated with acidosis. Cancer cells respond to these stresses with changes in gene expression that promote survival at least in part through pH regulation and metabolic reprogramming. Hypoxia-induced carbonic anhydrase
Min-Chieh Hsin et al.
Cancers, 13(5) (2021-04-04)
Carbonic anhydrase IX (CAIX) is a hypoxia-induced protein that is highly expressed in numerous human cancers. However, the molecular mechanisms involved in CAIX and human cervical cancer metastasis remain poorly understood. In this study, CAIX overexpression in SiHa cells increased
Kuo-Tai Hua et al.
Scientific reports, 7(1), 4466-4466 (2017-07-02)
Carbonic anhydrase IX (CA9) expression level has been considered as a poor prognostic factor in hepatocellular carcinoma (HCC) patients. However, the judging criteria of CA9 level is hard to define for potential clinical applications. Unlike CA9 expression level, CA9 polymorphism
Somayeh Jamali et al.
Scientific reports, 5, 13605-13605 (2015-09-05)
The most aggressive tumour cells, which often reside in hypoxic environments, rely on glycolysis for energy production. Thereby they release vast amounts of lactate and protons via monocarboxylate transporters (MCTs), which exacerbates extracellular acidification and supports the formation of a

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico