Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU034841

Sigma-Aldrich

MISSION® esiRNA

targeting human FDXR

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGGATTTCTTGGGTCTCCAGGACAAGATCAAGGAGGTCCCCCGCCCGAGGAAGCGGCTGACGGAACTGCTGCTTCGAACGGCCACAGAGAAGCCAGGGCCGGCGGAAGCTGCCCGCCAGGCATCGGCCTCCCGTGCCTGGGGCCTCCGCTTTTTCCGAAGCCCCCAGCAGGTGCTGCCCTCACCAGATGGGCGGCGGGCAGCAGGTGTCCGCCTAGCAGTCACTAGACTGGAGGGTGTCGATGAGGCCACCCGTGCAGTGCCCACGGGAGACATGGAAGACCTCCCTTGTGGGCTGGTGCTCAGCAGCATTGGGTATAAGAGCCGCCCTGTCGACCCAAGCGTGCCCTTTGACTCCAAGCTTGGGGTCATCCCCAATGTGGAGGGCCGGGTTATGGATGTGCCAGGCCTCTACTGCAGCGGCTGGGTGAAGAGAGGACCTACAGGTGTCATAGCCACAACCATGACTGACAGC

Ensembl | nº de acceso humano

ENSG00000161513

Nº de acceso NCBI

NM_004110

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... FDXR(2232) , FDXR(2232)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QCS
DOR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Valerie N Barton et al.
Molecular cancer therapeutics, 14(3), 769-778 (2015-02-26)
Triple-negative breast cancer (TNBC) has the lowest 5-year survival rate of invasive breast carcinomas, and currently there are no approved targeted therapies for this aggressive form of the disease. The androgen receptor (AR) is expressed in up to one third
S H Akter et al.
Veterinary pathology, 52(6), 1027-1033 (2015-03-11)
Controversies remain regarding the cell type from which human prostate cancer originates, and many attempts have been made to identify the cellular origin of canine prostate cancer but without definitive proof. This study aims to evaluate the expression of luminal
Tao Shan et al.
Cancer science, 105(7), 847-856 (2014-05-13)
Norepinephrine and epinephrine, catecholamine hormones that are major mediators for chronic stress-induced cancers, are implicated in the progression of a number of cancer cells, including gastric adenocarcinoma. However, the underlying mechanisms of these hormones have not been well elucidated. Epithelial-mesenchymal
Luofu Wang et al.
PloS one, 9(5), e96586-e96586 (2014-05-07)
The objective of this study was to investigate nanobubbles carrying androgen receptor (AR) siRNA and their in vitro and in vivo anti-tumor effects, when combined with ultrasonic irradiation, on androgen-independent prostate cancer (AIPC). Nanobubbles carrying AR siRNA were prepared using
Xiaolong Du et al.
Experimental biology and medicine (Maywood, N.J.), 240(11), 1472-1479 (2015-05-15)
Angiogenesis is critical to wound repair due to its role in providing oxygen and nutrients that are required to support the growth and function of reparative cells in damaged tissues. Adenosine receptors are claimed to be of paramount importance in
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico