Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos

EHU034701

Sigma-Aldrich

MISSION® esiRNA

targeting human ROCK1 (2)

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGACAGAATCGGACACAGCTGTAAGATTGAGGAAGAGTCACACAGAGATGAGCAAGTCAATTAGTCAGTTAGAGTCCCTGAACAGAGAGTTGCAAGAGAGAAATCGAATTTTAGAGAATTCTAAGTCACAAACAGACAAAGATTATTACCAGCTGCAAGCTATATTAGAAGCTGAACGAAGAGACAGAGGTCATGATTCTGAGATGATTGGAGACCTTCAAGCTCGAATTACATCTTTACAAGAGGAGGTGAAGCATCTCAAACATAATCTCGAAAAAGTGGAAGGAGAAAGAAAAGAGGCTCAAGACATGCTTAATCACTCAGAAAAGGAAAAGAATAATTTAGAGATAGATTTAAACTACAAACTTAAATCATTACAACAACGGTTAGAACAAGAGGTAAATGAACACAAAGTAACCAAAGCTCGTTTAACTGACAAACATCAATCTATTGAAGAGGCAAAGTCTGTGGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wen-Di Zhou et al.
International journal of oncology, 51(6), 1831-1841 (2017-10-19)
Actein is a tetracyclic triterpenoid compound, extracted from the rhizome of Cimicifuga foetida, exhibiting anticancer activities as previously reported. However, the effects of actein on human leukemia have not been explored before. In this study, the role of actein in
Jialing Rao et al.
Scientific reports, 7, 39727-39727 (2017-01-06)
A recent study demonstrated that advanced glycation end products (AGEs) play a role in monocyte infiltration in mesangial areas in diabetic nephropathy. The Ras homolog gene family, member A Rho kinase (RhoA/ROCK) pathway plays a role in regulating cell migration.
Dongmei Wang et al.
OncoTargets and therapy, 13, 361-370 (2020-02-06)
Propofol has been identified to perform anti-tumor functions in glioma. However, the molecular mechanisms underlying propofol-induced prevention on migration and invasion of glioma cells remain unclear. Cell proliferation, invasion and migration were measured by 3-(4,5)-dimethylthiahiazo(-z-y1)-3,5-di-phenytetrazoliumromide assay and transwell assay, respectively.
Gentao Fan et al.
Frontiers in bioscience (Landmark edition), 24, 1167-1177 (2019-05-29)
miR-139 has a tumor suppressor effect in many tumors. Here, we examined the suppressive role of this miRNA and its target, ROCK1, in osteosarcoma (OS), a highly malignant bone tumor that mainly affects children and adolescents. The expression of miR-139
Candelas Álvarez-Salamero et al.
PLoS biology, 18(3), e3000646-e3000646 (2020-03-24)
Interleukin 23 (IL-23) triggers pathogenic features in pro-inflammatory, IL-17-secreting T cells (Th17 and Tγδ17) that play a key role in the development of inflammatory diseases. However, the IL-23 signaling cascade remains largely undefined. Here, we used quantitative phosphoproteomics to characterize

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico