Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU034601

Sigma-Aldrich

MISSION® esiRNA

targeting human GPC5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGGAATGAAGACCACCACAAGGAACAGTGAAGAGACGCTTGCCAACAGAAGAAAAGAATTTATCAACAGCCTTCGACTGTACAGGTCATTCTATGGAGGTCTAGCTGATCAGCTTTGTGCTAATGAATTAGCTGCTGCAGATGGACTTCCCTGCTGGAATGGAGAAGATATAGTAAAAAGTTATACTCAGCGTGTGGTTGGAAATGGAATCAAAGCCCAGTCTGGAAATCCTGAAGTCAAAGTCAAAGGAATTGATCCTGTGATAAATCAGATTATTGATAAACTGAAGCATGTTGTTCAGTTGTTACAGGGTAGATCACCCAAACCTGACAAGTGGGAACTTCTTCAGCTGGGCAGTGGTGGAGGCATGGTTGAACAAGTCAGTGGGGACTGTGATGATGAAGATGGTTGCGGGGGATCAGGAAGTGGAGAAGTCAAGAGGACACTGAAGATCACAGACTGGATGCCAGATG

Ensembl | nº de acceso humano

ENSG00000179399

Nº de acceso NCBI

NM_004466

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... GPC5(2262) , GPC5(2262)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
DOR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Masao Takeuchi et al.
PloS one, 16(2), e0226538-e0226538 (2021-02-20)
Glypican-5 (GPC5) is a heparan sulfate proteoglycan (HSPG) localized to the plasma membrane. We previously reported that in the human mesenchymal stem cell line UE6E7T-3, GPC5 is overexpressed in association with transformation and promotes cell proliferation by acting as a
Xin Hong et al.
European journal of pharmacology, 854, 39-47 (2019-04-06)
Accumulating evidence has suggested that Glypican-5 (GPC5) is a tumor suppressor gene in many types of cancers. However, whether GPC5 is involved in glioma remains unknown. This study was designed to explore the expression, biological function and regulatory mechanism of
Koji Okamoto et al.
The American journal of pathology, 185(7), 1889-1898 (2015-05-20)
Type 2 diabetes mellitus is a leading health issue worldwide. Among cases of diabetes mellitus nephropathy (DN), the major complication of type 2 diabetes mellitus, the nephrotic phenotype is often intractable to clinical intervention and demonstrates the rapid decline of

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico