Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU034321

Sigma-Aldrich

MISSION® esiRNA

targeting human CP

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GAATGGACTGTCCCCAAAGAAGTAGGACCCACTAATGCAGATCCTGTGTGTCTAGCTAAGATGTATTATTCTGCTGTGGAACCCACTAAAGATATATTCACTGGGCTTATTGGGCCAATGAAAATATGCAAGAAAGGAAGTTTACATGCAAATGGGAGACAGAAAGATGTAGACAAGGAATTCTATTTGTTTCCTACAGTATTTGATGAGAATGAGAGTTTACTCCTGGAAGATAATATTAGAATGTTTACAACTGCACCTGATCAGGTGGATAAGGAAGATGAAGACTTTCAGGAATCTAATAAAATGCACTCCATGAATGGATTCATGTATGGGAATCAGCCGGGTCTCACTATGTGCAAAGGAGATTCGGTCGTGTGGTACTTATTCAGCGCCGGAAATGAGGCCGATGTACATGGAATATACTTTTCAGGAAACACATATCTGTGGAGAGGAGAACGGAGAGACACAGC

Ensembl | nº de acceso humano

ENSG00000047457

Nº de acceso NCBI

NM_000096

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CP(1356) , CP(1356)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Pei-Wen Wang et al.
International journal of molecular sciences, 20(18) (2019-09-25)
Wilson's disease (WD) is an autosomal recessive disorder of copper metabolism caused by defects in the ATPase gene (ATP7B). The various clinical features result from the massive accumulation of copper in the liver, cornea and basal ganglia. Although WD can
Yi Zhang et al.
Experimental cell research, 358(2), 234-241 (2017-07-01)
Neddylation inhibitor Pevonedistat (MLN4924) is a novel anticancer drug and has demonstrated broad-spectrum anticancer activity. Nevertheless, we found that Pevonedistat had only a modest apoptotic effect in osteosarcoma (OS) cells. Moreover, we noted that inhibition of neddylation by Pevonedistat led
Seong Hye Park et al.
Oncogene, 39(1), 136-150 (2019-08-30)
Hypoxia, or the deficiency of oxygen, in solid tumors is majorly responsible for the progression of cancer and remains unaffected by chemotherapy, but still requires definitive definition of the hypoxia signaling. Hypoxia disrupts the complete folding of mitochondrial proteins, leading
H-L Huang et al.
Oncogenesis, 6(7), e359-e359 (2017-07-12)
MUC1-C overexpression has been associated with the progression of pancreatic tumors by promoting the aggressive and metastatic phenotypes. As MUC1 is a STAT3 target gene, STAT3 plays a major role in regulating MUC1-C expression. In this study, we report an
Gang Liu et al.
Cell death & disease, 10(10), 688-688 (2019-09-20)
CELF6, a member of the CELF family of RNA-binding proteins, regulates muscle-specific alternative splicing and contributes to the pathogenesis of myotonic dystrophy (DM), however the role of CELF6 in cancer cell proliferation is less appreciated. Here, we show that the
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico