Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU033221

Sigma-Aldrich

MISSION® esiRNA

targeting human TYROBP

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
$220.00
50 μG
$391.00

$220.00


Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).


Seleccione un Tamaño

Cambiar Vistas
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTGGCTGTAAGTGGTCTCCGTCCTGTCCAGGCCCAGGCCCAGAGCGATTGCAGTTGCTCTACGGTGAGCCCGGGCGTGCTGGCAGGGATCGTGATGGGAGACCTGGTGCTGACAGTGCTCATTGCCCTGGCCGTGTACTTCCTGGGCCGGCTGGTCCCTCGGGGGCGAGGGGCTGCGGAGGCAGCGACCCGGAAACAGCGTATCACTGAGACCGAGTCGCCTTATCAGGAGCTCCAGGGTCAGAGGTCGGATGTCTACAGCGACCTCAACACACAGAGGCCGTATTACAAATGAGCCCGAATCATGACAGTCAGCAACATGATACCTGGATCCAGCCATTCCTGAAGCCCACCCTGCACCTCATTCCAACTCCTACCGCGATACAGACCCACAGAGTGCCATCCCTGAGAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Teng Jiang et al.
Neuropsychopharmacology : official publication of the American College of Neuropsychopharmacology, 39(13), 2949-2962 (2014-07-23)
Triggering receptor expressed on myeloid cells 2 (TREM2) gene is a recently identified susceptibility gene for Alzheimer's disease (AD), as its low-frequency variants increase the risk of this disease with an odds ratio similar to that of an APOE ɛ4
Tania N Crotti et al.
Arthritis research & therapy, 14(6), R245-R245 (2012-11-14)
The immunoreceptor tyrosine-based activation motif (ITAM) pathway provides osteoclast co-stimulatory signals and regulates proliferation, survival and differentiation of effector immune cells. In the osteoclast, the receptors Triggering Receptor Expressed on Myeloid cells 2 (TREM2) and Osteoclast Associated Receptor (OSCAR) and
Kevin Carrasco et al.
Cellular & molecular immunology, 16(5), 460-472 (2018-03-24)
The triggering receptor expressed on myeloid cells-1 (TREM-1) is a receptor expressed on innate immune cells. By promoting the amplification of inflammatory signals that are initially triggered by Toll-like receptors (TLRs), TREM-1 has been characterized as a major player in

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico