Saltar al contenido
MilliporeSigma
Todas las fotos(2)

Documentos clave

EHU032581

Sigma-Aldrich

MISSION® esiRNA

targeting human CAPN1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GACATGGAGATCAGCGTGAAGGAGTTGCGGACAATCCTCAATAGGATCATCAGCAAACACAAAGACCTGCGGACCAAGGGCTTCAGCCTAGAGTCGTGCCGCAGCATGGTGAACCTCATGGATCGTGATGGCAATGGGAAGCTGGGCCTGGTGGAGTTCAACATCCTGTGGAACCGCATCCGGAATTACCTGTCCATCTTCCGGAAGTTTGACCTGGACAAGTCGGGCAGCATGAGTGCCTACGAGATGCGGATGGCCATTGAGTCGGCAGGCTTCAAGCTCAACAAGAAGCTGTACGAGCTCATCATCACCCGCTACTCGGAGCCCGACCTGGCGGTCGACTTTGACAATTTCGTTTGCTGCCTGGTGCGGCTAGAGACCATGTTCCGATTTTTCAAAACTCTGGACACAGATCTGGATGGAGTTGTGACCTTTGACTTGTTTAAGTGGTTGCAGCTGACCATGTTTGCATGAGG

Ensembl | nº de acceso humano

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Meei-Ling Sheu et al.
Oncotarget, 8(12), 19376-19388 (2016-12-31)
Ochratoxin A (OTA) contaminated food increases reactive oxygen species (ROS) production in glomerulus and causes glomerulopathy. The molecular mechanisms still remain uncertain. In this study, we used mouse and rat glomerular mesangial cells and delineate the signaling pathway behind the
L M Yu et al.
Clinical & translational oncology : official publication of the Federation of Spanish Oncology Societies and of the National Cancer Institute of Mexico, 21(7), 924-932 (2018-12-20)
Pancreatic cancer (PC) is a highly aggressive and metastatic disease, with an elevated mortality rate. It is, therefore, crucial to assess factors affecting the prognosis of PC patients. Meanwhile, calpain-1 is associated with malignant tumor progression and metastasis. Thus, it
Mathieu Chocry et al.
Oncotarget, 8(61), 103710-103730 (2017-12-22)
Oxaliplatin is a major treatment for metastatic colorectal cancer, however its effectiveness is greatly diminished by the development of resistances. Our previous work has shown that oxaliplatin efficacy depends on the reactive oxygen species (ROS) produced by Nox1. In this

Artículos

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico