Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU031291

Sigma-Aldrich

MISSION® esiRNA

targeting human DKC1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGTGTGCACCTTGGTTTGTTATTGGGAGTTGGTGGTCAGATGCAGGAGCTTCGGAGGGTTCGTTCTGGAGTCATGAGTGAAAAGGACCACATGGTGACAATGCATGATGTGCTTGATGCTCAGTGGCTGTATGATAACCACAAGGATGAGAGTTACCTGCGGCGAGTTGTTTACCCTTTGGAAAAGCTGTTGACATCTCATAAACGGCTGGTTATGAAAGACAGTGCAGTAAATGCCATCTGCTATGGGGCCAAGATTATGCTTCCAGGTGTTCTTCGATATGAGGACGGCATTGAGGTCAATCAGGAGATTGTGGTTATCACCACCAAAGGAGAAGCAATCTGCATGGCTATTGCATTAATGACCACAGCGGTCATCTCTACCTGCGACCATGGTATAGTAGCCAAGATCAAGAGAGTGATCATGGAGAGAGACACTTACCCTCGGAAGTGGGGTTTAGGTCCAAAGGCAAGTCAGA

Ensembl | nº de acceso humano

ENSG00000130826

Nº de acceso NCBI

NM_001363

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... DKC1(1736) , DKC1(1736)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QCS
FQR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Khloud A Elsharawy et al.
British journal of cancer, 123(10), 1543-1552 (2020-09-02)
Hypertrophy of the nucleolus is a distinctive cytological feature of malignant cells and corresponds to aggressive behaviour. This study aimed to identify the key gene associated with nucleolar prominence (NP) in breast cancer (BC) and determine its prognostic significance. From
Vahid Khoddami et al.
Proceedings of the National Academy of Sciences of the United States of America, 116(14), 6784-6789 (2019-03-16)
The breadth and importance of RNA modifications are growing rapidly as modified ribonucleotides can impact the sequence, structure, function, stability, and fate of RNAs and their interactions with other molecules. Therefore, knowing cellular RNA modifications at single-base resolution could provide
Pingfu Hou et al.
British journal of cancer, 122(5), 668-679 (2019-12-21)
Dyskeratosis congenita 1 (DKC1) is dysregulated in several cancers. However, the expression and function of DKC1 in colorectal cancer (CRC) is rarely reported. Tissue microarrays (TAMs) including 411 cases of CRC tissues and corresponding paracancerous tissues were used to examine
Meng Zhang et al.
Oncology reports, 40(2), 968-978 (2018-06-15)
DKC1, an X‑linked gene encoding dyskerin at Xq28, is a crucial component of the telomerase complex and is indispensable for normal telomere function and the post‑-transcriptional modification of precursor rRNA. It has been revealed to exert diverse biological functions and
Nunzia Di Maio et al.
FEBS open bio, 7(10), 1453-1468 (2017-10-06)
Dyskerin is an essential, conserved, multifunctional protein found in the nucleolus, whose loss of function causes the rare genetic diseases X-linked dyskeratosis congenita and Hoyeraal-Hreidarsson syndrome. To further investigate the wide range of dyskerin's biological roles, we set up stable
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico