Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU028511

Sigma-Aldrich

MISSION® esiRNA

targeting human PCK2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACAACTTCGGGCACTACCTGGAACACTGGCTGAGCATGGAAGGGCGCAAGGGGGCCCAGCTGCCCCGTATCTTCCATGTCAACTGGTTCCGGCGTGACGAGGCAGGGCACTTCCTGTGGCCAGGCTTTGGGGAGAATGCTCGGGTGCTAGACTGGATCTGCCGGCGGTTAGAGGGGGAGGACAGTGCCCGAGAGACACCCATTGGGCTGGTGCCAAAGGAAGGAGCCTTGGATCTCAGCGGCCTCAGAGCTATAGACACCACTCAGCTGTTCTCCCTCCCCAAGGACTTCTGGGAACAGGAGGTTCGTGACATTCGGAGCTACCTGACAGAGCAGGTCAACCAGGATCTGCCCAAAGAGGTGTTGGCTGAGCTTGAGGCCCTGGAGAGACGTGTGCACAAAATGTGACCTGAGGCC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Elisabeth Smolle et al.
Molecular oncology, 14(11), 2853-2867 (2020-08-11)
Inhibition of glycolysis has been considered as a therapeutic approach in aggressive cancers including lung cancer. Abbreviated gluconeogenesis, mediated by phosphoenolpyruvate carboxykinase (PEPCK), was recently discovered to partially circumvent the need for glycolysis in lung cancer cells. However, the interplay
Jiangsha Zhao et al.
Oncotarget, 8(48), 83602-83618 (2017-11-16)
Tumor-initiating cells (TICs) play important roles in tumor progression and metastasis. Identifying the factors regulating TICs may open new avenues in cancer therapy. Here, we show that TIC-enriched prostate cancer cell clones use more glucose and secrete more lactate than
S Luo et al.
Oncogene, 36(25), 3609-3617 (2017-02-07)
For cancer cells to proliferate, a balance must be built between biomass-forming, glucose-metabolized intermediates and ATP production. How intrinsic glucose carbon flow regulates this balance remains unclear. Here we show that mitochondrial phosphoenolpyruvate carboxykinase (PCK2), the hub molecule linking tricarboxylic

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico