Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU025551

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC9A1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CACCACTGGAACTGGACCTTCGTCATCAGCACCCTGCTCTTCTGCCTCATCGCCCGCGTGCTGGGGGTGCTGGGCCTGACCTGGTTCATCAACAAGTTCCGTATCGTGAAGCTGACCCCCAAGGACCAGTTCATCATCGCCTATGGGGGCCTGCGAGGGGCCATCGCCTTCTCTCTGGGCTACCTCCTGGACAAGAAGCACTTCCCCATGTGTGACCTGTTCCTCACTGCCATCATCACTGTCATCTTCTTCACCGTCTTTGTGCAGGGCATGACCATTCGGCCCCTGGTAGACCTGTTGGCTGTGAAGAAAAAGCAAGAGACGAAGCGCTCCATCAACGAAGAGATCCACACACAGTTCCTGGACCACCTTCTGACAGGCATCGAAGACATCTGTGGCCACTACGGTCACCACCACTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yosuke Ariyoshi et al.
Oncotarget, 8(2), 2209-2223 (2016-12-03)
Na+/H+ exchanger 1 (NHE1) is a plasma membrane transporter that controls intracellular pH and regulates apoptosis and invasion in various cancer cells. However, the function of NHE1 in esophageal squamous cell carcinoma (ESCC) cells and the relationship between the expression
A K Pedersen et al.
BMC cancer, 17(1), 542-542 (2017-08-16)
Chronic angiogenesis is a hallmark of most tumors and takes place in a hostile tumor microenvironment (TME) characterized by hypoxia, low nutrient and glucose levels, elevated lactate and low pH. Despite this, most studies addressing angiogenic signaling use hypoxia as
Zhenni Sun et al.
OncoTargets and therapy, 13, 8521-8532 (2020-09-10)
Several recent studies have addressed the role of Na+/H+ exchanger isoform 1 (NHE1) in tumor cell growth and apoptosis, including in gastric cancer. However, the role of NHE1 expression related to the 5-Fu resistance in gastric cancer has not been
Yogesh Singh et al.
The Journal of biological chemistry, 291(45), 23662-23671 (2016-09-16)
CD4
Raj R Malinda et al.
Frontiers in oncology, 10, 687-687 (2020-05-28)
Pancreatic ductal adenocarcinoma (PDAC) is a major cause of cancer-related death, with a 5-year survival of <10% and severely limited treatment options. PDAC hallmarks include profound metabolic acid production and aggressive local proliferation and invasiveness. This phenotype is supported by

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico