Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU024691

Sigma-Aldrich

MISSION® esiRNA

targeting human CDH3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATTGGGTGGTTGCTCCAATATCTGTCCCTGAAAATGGCAAGGGTCCCTTCCCCCAGAGACTGAATCAGCTCAAGTCTAATAAAGATAGAGACACCAAGATTTTCTACAGCATCACGGGGCCGGGGGCAGACAGCCCCCCTGAGGGTGTCTTCGCTGTAGAGAAGGAGACAGGCTGGTTGTTGTTGAATAAGCCACTGGACCGGGAGGAGATTGCCAAGTATGAGCTCTTTGGCCACGCTGTGTCAGAGAATGGTGCCTCAGTGGAGGACCCCATGAACATCTCCATCATCGTGACCGACCAGAATGACCACAAGCCCAAGTTTACCCAGGACACCTTCCGAGGGAGTGTCTTAGAGGGAGTCCTACCAGGTACTTCTGTGATGCAGGTGACAGCCACGGATGAGGATGATGCCATCTACACCTACAATGGGGTGGTTGCTTACTCCATCCATAGCCAAGAACCAAAGGACCCACACGACCTCATGTTCAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Li Li et al.
International journal of biological sciences, 15(5), 953-961 (2019-06-12)
P-cadherin (CDH3), a classical cell adhesion molecule involved in tissue integrity and cell localization, has been implicated in many types of cancer. However, little is known about its function and regulatory mechanism in hepatocellular carcinoma (HCC). Here we report that
Ting-Feng Hsiao et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 26(13), 3220-3229 (2020-03-12)
EGFR tyrosine kinase inhibitors (EGFR-TKI) benefit patients with advanced lung adenocarcinoma (ADC) harboring activating EGFR mutations. We aimed to identify biomarkers to monitor and predict the progression of patients receiving EGFR-TKIs via a comprehensive omic analysis. We applied quantitative proteomics
A S Ribeiro et al.
Nanoscale, 8(46), 19390-19401 (2016-11-17)
Physical forces mediated by cell-cell adhesion molecules, as cadherins, play a crucial role in preserving normal tissue architecture. Accordingly, altered cadherins' expression has been documented as a common event during cancer progression. However, in most studies, no data exist linking

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico