Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos

EHU024581

Sigma-Aldrich

MISSION® esiRNA

targeting human PDCD6IP

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAAAGCCACACTTGTGAAATCTACCCCGGTCAATGTACCCATCAGTCAGAAATTTACTGATCTGTTTGAGAAGATGGTTCCCGTGTCAGTACAGCAGTCTTTGGCTGCCTATAATCAGAGGAAAGCCGATTTGGTTAACAGATCAATTGCTCAGATGAGAGAAGCCACCACTTTGGCAAATGGGGTGCTAGCTTCCCTTAATCTTCCAGCAGCAATTGAAGATGTGTCTGGAGACACTGTACCTCAGTCTATATTGACTAAATCCAGATCTGTGATTGAACAGGGAGGCATCCAGACTGTTGATCAGTTGATTAAAGAACTGCCTGAATTACTGCAACGAAATAGAGAAATCCTAGATGAGTCATTAAGGTTGTTGGATGAAGAAGAAGCAACCGATAATGATTTAAGAGCAAAATTTAAGGAACGTTGGCAAAGGACACCATCCAATGAACTGTATAAGCCTTTAAGAGCAGAGGGAACCAACTTCA

Ensembl | human accession no.

ENSG00000170248

NCBI accession no.

NM_013374

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PDCD6IP(10015) , PDCD6IP(10015)

Categorías relacionadas

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Julianne V de Carvalho et al.
PloS one, 9(11), e113691-e113691 (2014-11-26)
Nef is an HIV-1 accessory protein that promotes viral replication and pathogenesis. A key function of Nef is to ensure sustained depletion of CD4 and MHC-I molecules in infected cells by inducing targeting of these proteins to multivesicular bodies (MVBs)
Li Zhong et al.
Signal transduction and targeted therapy, 6(1), 59-59 (2021-02-12)
It remains unknown for decades how some of the therapeutic fusion proteins positive in a small percentage of cancer cells account for patient outcome. Here, we report that osteosarcoma Rab22a-NeoF1 fusion protein, together with its binding partner PYK2, is sorted
Allaura S Cone et al.
BMC molecular and cell biology, 21(1), 58-58 (2020-08-01)
Endosomal trafficking and amyloidogenic cleavage of amyloid precursor protein (APP) is believed to play a role in the neurodegeneration observed in Alzheimer's disease (AD). Recent evidence has suggested that packaging and secretion of APP and its amyloidogenic cleaved products into
Brian A Davies et al.
Molecular biology of the cell, 31(22), 2463-2474 (2020-08-28)
Intercellular communication is critical for organismal homeostasis, and defects can contribute to human disease states. Polarized epithelial cells execute distinct signaling agendas via apical and basolateral surfaces to communicate with different cell types. Small extracellular vesicles (sEVs), including exosomes and

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico