Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EHU024211

Sigma-Aldrich

MISSION® esiRNA

targeting human XDH

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATTTCCGCTGATGATGTTCCTGGGAGTAACATAACTGGAATTTGTAATGATGAGACAGTCTTTGCGAAGGATAAGGTTACTTGTGTTGGGCATATCATTGGTGCTGTGGTTGCTGACACCCCGGAACACACACAGAGAGCTGCCCAAGGGGTGAAAATCACCTATGAAGAACTACCAGCCATTATCACAATTGAGGATGCTATAAAGAACAACTCCTTTTATGGACCTGAGCTGAAGATCGAGAAAGGGGACCTAAAGAAGGGGTTTTCCGAAGCAGATAATGTTGTGTCAGGGGAGATATACATCGGTGGCCAAGAGCACTTCTACCTGGAGACTCACTGCACCATTGCTGTTCCAAAAGGCGAGGCAGGGGAGATGGAGCTCTTTGTGTCTACACAGAACACCATGAAGACCCAGAGC

Ensembl | human accession no.

ENSG00000158125

NCBI accession no.

NM_000379

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... XDH(7498) , XDH(7498)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

G-L Chen et al.
Oncogenesis, 6(9), e382-e382 (2017-09-26)
Xanthine dehydrogenase (XDH), a rate-limiting enzyme involved in purine metabolism, has an essential role in inflammatory cascades. Researchers have known for decades that XDH activity is decreased in some cancers, including hepatocellular carcinoma (HCC). However, the role of XDH in
You-Jin Kim et al.
International journal of molecular sciences, 21(20) (2020-10-15)
In the present study, we investigated the effects of xanthine oxidase (XO) inhibition on cholesterol-induced renal dysfunction in chronic kidney disease (CKD) mice, and in low-density lipoprotein (LDL)-treated human kidney proximal tubule epithelial (HK-2) cells. ApoE knockout (KO) mice underwent
Haixia Xu et al.
Free radical biology & medicine, 139, 70-79 (2019-05-20)
The natural compound Alternol was shown to induce profound oxidative stress and apoptotic cell death preferentially in cancer cells. In this study, a comprehensive investigation was conducted to understand the mechanism for Alternol-induced ROS accumulation responsible for apoptotic cell death.
Se-Hyun Oh et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(6), 7301-7314 (2019-03-13)
Hypercholesterolemia is reported to increase reactive oxygen species (ROS) and to promote breast cancer progression. ROS play an important role in tumor biology, and xanthine oxidase (XO) is an enzyme that generates ROS. The effects of febuxostat (FBX), an XO
Seon Min Woo et al.
Oncotarget, 8(63), 106672-106684 (2018-01-02)
Cathepsin G is a serine protease secreted from activated neutrophils, it has important roles in inflammation and immune response. Moreover, cathepsin G promotes tumor cell-cell adhesion and migration in cancer cells. In this study, we investigated whether inhibition of cathepsin

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico