Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU022341

Sigma-Aldrich

MISSION® esiRNA

targeting human BCL9

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCACCTGGATGGACCTCTTCTCCAAAACCTCCCCTTCAGAGTCCTGGGATCCCTCCAAACCATAAAGCACCCCTCACCATGGCCTCCCCAGCCATGCTGGGAAATGTAGAGTCAGGTGGCCCCCCACCTCCTACAGCCAGCCAGCCTGCCTCTGTGAATATCCCTGGAAGTCTTCCCTCTAGTACACCTTATACCATGCCTCCAGAGCCAACCCTTTCCCAGAACCCACTCTCTATTATGATGTCTCGAATGTCCAAGTTTGCAATGCCCAGTTCCACCCCGTTATACCATGATGCTATCAAGACTGTGGCCAGCTCAGATGACGACTCCCCTCCAGCTCGTTCTCCCAACTTGCCATCAATGAATAATATGCCAGGAATGGGCATTAATACACAGAATCCTCGAATTTCAGGTCCAAACCCCGTGGTTCCGATGCCAACCCTCAGCCCAATGGGAATGACCCAGCCACTTTCTCACTCCAATCAGATGCCCTCTC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Chao Yang et al.
Cell death & disease, 8(8), e2999-e2999 (2017-08-18)
Metastasis is the major cause of the poor prognosis of hepatocellular carcinoma (HCC), and increasing evidence supports the contribution of miRNAs to cancer progression. However, the exact relationship between the level of miR-1301 expression and HCC cell migration, invasion, and
Hanan S Elsarraj et al.
Breast cancer research : BCR, 17, 128-128 (2015-09-19)
There are an estimated 60,000 new cases of ductal carcinoma in situ (DCIS) each year. A lack of understanding in DCIS pathobiology has led to overtreatment of more than half of patients. We profiled the temporal molecular changes during DCIS

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico