Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU022331

Sigma-Aldrich

MISSION® esiRNA

targeting human EDN1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
$220.00
50 μG
$391.00

$220.00

Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
$220.00
50 μG
$391.00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

$220.00

Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCAAGGAGCTCCAGAAACAGCAGTCTTAGGCGCTGAGCTCAGCGCGGTGGGTGAGAACGGCGGGGAGAAACCCACTCCCAGTCCACCCTGGCGGCTCCGCCGGTCCAAGCGCTGCTCCTGCTCGTCCCTGATGGATAAAGAGTGTGTCTACTTCTGCCACCTGGACATCATTTGGGTCAACACTCCCGAGCACGTTGTTCCGTATGGACTTGGAAGCCCTAGGTCCAAGAGAGCCTTGGAGAATTTACTTCCCACAAAGGCAACAGACCGTGAAAATAGATGCCAATGTGCTAGCCAAAAAGACAAGAAGTGCTGGAATTTTTGCCAAGCAGGAAAAGAACTCAGGGCTGAAGACATTATGGAGAAAGACTGGAATAATCATAAGAAAGGAAAAGACTGTTCCAAGCTTGGGAAAAAGTGTATTTATCAGCAGTTAGTGAGAGGAAGAAAAATCAGAAGAAGTTCAGAGGAACACCTAAGACAAACCAGGTCGGAGA

Ensembl | nº de acceso humano

ENSG00000078401

Nº de acceso NCBI

NM_001955

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... EDN1(1906) , EDN1(1906)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yan Hao et al.
Diabetes, metabolic syndrome and obesity : targets and therapy, 14, 1405-1418 (2021-04-02)
Mesenchymal stem cell (MSC)-derived exosomes have seen great advances in human disease control in a minimally invasive manner. This research aimed to explore the function of MSC-derived exosomes in diabetic nephropathy (DN) progression and the molecules involved. A rat model
Xianwei Wang et al.
Journal of molecular and cellular cardiology, 80, 101-109 (2015-01-15)
Endothelin-1 (ET-1) plays a major role in regulating myocardial fibrosis in several pathological conditions, such as hypertension and diabetes. Aging is an independent risk factor for myocardial fibrosis. We hypothesized that ET-1 upregulation may be a basis of enhanced collagen
Shannon N Acker et al.
Pediatric research, 77(4), 511-519 (2015-01-13)
Pulmonary hypertension (PH) secondary to vascular remodeling contributes to poor outcomes in congenital diaphragmatic hernia (CDH), however mechanisms responsible are unknown. We hypothesized that pulmonary artery endothelial cell (PAEC) dysfunction contributes to smooth muscle cell (SMC) hyperplasia in experimental CDH.

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico