Saltar al contenido
MilliporeSigma

EHU020491

Sigma-Aldrich

MISSION® esiRNA

targeting human CFTR

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AAGAATGGCCAACTCTCGAAAGTTATGATTATTGAGAATTCACACGTGAAGAAAGATGACATCTGGCCCTCAGGGGGCCAAATGACTGTCAAAGATCTCACAGCAAAATACACAGAAGGTGGAAATGCCATATTAGAGAACATTTCCTTCTCAATAAGTCCTGGCCAGAGGGTGGGCCTCTTGGGAAGAACTGGATCAGGGAAGAGTACTTTGTTATCAGCTTTTTTGAGACTACTGAACACTGAAGGAGAAATCCAGATCGATGGTGTGTCTTGGGATTCAATAACTTTGCAACAGTGGAGGAAAGCCTTTGGAGTGATACCACAGAAAGTATTTATTTTTTCTGGAACATTTAGAAAAAACTTGGATCCCTATGAACAGTGGAGTGATCAAGAAATATGGAAAGTTGCAGATGAGGTTGGG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yonghwan Shin et al.
Journal of clinical medicine, 9(3) (2020-03-19)
Cystic fibrosis transmembrane conductance regulator (CFTR), a cyclic AMP (cAMP)-regulated chloride channel, is critical for secretion and absorption across diverse epithelia. Mutations or absence of CFTR result in pathogeneses, including cancer. While CFTR has been proposed as a tumor suppressing
Luiz Felipe M Prota et al.
PloS one, 7(12), e47405-e47405 (2012-12-29)
Dexamethasone is widely used for pulmonary exacerbation in patients with cystic fibrosis, however, not much is known about the effects of glucocorticoids on the wild-type cystic fibrosis channel transmembrane regulator (CFTR). Our aim was to determine the effects of dexamethasone
Babita Kaundal et al.
Journal of materials chemistry. B, 8(37), 8658-8670 (2020-08-28)
Acute myeloid leukemia (AML), which is common in the elderly population, accounts for poor long-term survival with a high possibility of relapse. The associated lack of currently developed therapeutics is directing the search for new therapeutic targets relating to AML.
Maria Favia et al.
Molecular biology of the cell, 21(1), 73-86 (2009-11-06)
We have demonstrated that Na(+)/H(+) exchanger regulatory factor 1 (NHERF1) overexpression in CFBE41o- cells induces a significant redistribution of F508del cystic fibrosis transmembrane conductance regulator (CFTR) from the cytoplasm to the apical membrane and rescues CFTR-dependent chloride secretion. Here, we
C Norez et al.
British journal of pharmacology, 171(21), 4831-4849 (2014-07-30)
The most common mutation in cystic fibrosis (CF), F508del, causes defects in trafficking, channel gating and endocytosis of the CF transmembrane conductance regulator (CFTR) protein. Because CF is an orphan disease, therapeutic strategies aimed at improving mutant CFTR functions are

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico