Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

Ver Toda la documentación

EHU018921

Sigma-Aldrich

MISSION® esiRNA

targeting human MYBBP1A

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AAGCTCCCAAAGCAGTTCAAGTTTGCCCCAGAGATGGACGATTACGTGGGCACCTTCCTAGAGGGGTGCCAGGATGACCCTGAGCGGCAGCTGGCCGTGCTAGTGGCCTTCTCATCTGTCACCAACCAAGGCCTCCCTGTCACGCCTACTTTCTGGCGGGTCGTGCGGTTCCTGAGCCCTCCGGCCCTGCAGGGCTATGTGGCCTGGCTGCGGGCCATGTTTCTCCAGCCAGACCTGGACTCCTTGGTTGACTTCAGCACCAACAACCAGAAGAAAGCCCAGGATTCATCGCTCCACATGCCTGAGCGAGCTGTGTTCCGGCTGAGGAAATGGATCATCTTTCGATTGGTGAGCATTGTGGACAGCCTGCACCTGGAGATGGAGGAGGCCTTGACTGAGCAGGTGGCCAGGTTTTGTTTGTTCCACTCGTTCTTTGTCACAAAGAAGCCCACATCCCAGATCCCTGAGACAAAGCACCCGTTCTCCTTCCCTTTGGAAAACC

Ensembl | nº de acceso humano

ENSG00000132382

Nº de acceso NCBI

NM_001105538
NM_014520

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... MYBBP1A(10514) , MYBBP1A(10514)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Blanca Felipe-Abrio et al.
Cancers, 11(2) (2019-02-20)
Tumors are cellular ecosystems where different populations and subpopulations of cells coexist. Among these cells, cancer stem cells (CSCs) are considered to be the origin of the tumor mass, being involved in metastasis and in the resistance to conventional therapies.
Blanca Felipe-Abrio et al.
Molecular oncology, 13(7), 1519-1533 (2019-05-09)
The tumor microenvironment may alter the original tumorigenic potential of tumor cells. Under harsh environmental conditions, genetic alterations conferring selective advantages may initiate the growth of tumor subclones, providing new opportunities for these tumors to grow. We performed a genetic

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico