Saltar al contenido
MilliporeSigma

EHU018291

Sigma-Aldrich

MISSION® esiRNA

targeting human BCAP31

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCATTCCCTTCATTTCTCCTAAAAGATGGCAGAAGATTTTCAAGTCCCGGCTGGTGGAGTTGTTAGTGTCCTATGGCAACACCTTCTTTGTGGTTCTCATTGTCATCCTTGTGCTGTTGGTCATCGATGCCGTGCGCGAAATTCGGAAGTATGATGATGTGACGGAAAAGGTGAACCTCCAGAACAATCCCGGGGCCATGGAGCACTTCCACATGAAGCTTTTCCGTGCCCAGAGGAATCTCTACATTGCTGGCTTTTCCTTGCTGCTGTCCTTCCTGCTTAGACGCCTGGTGACTCTCATTTCGCAGCAGGCCACGCTGCTGGCCTCCAATGAAGCCTTTAAAAAGCAGGCGGAGAGTGCTAGTGAGGCGGCCAAGAAGTACATGGAGGAGAATGACCAGCTCAAGAAGGGAGCTGCTGTTGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Shuya Yang et al.
Frontiers in molecular biosciences, 7, 107-107 (2020-06-26)
Cervical cancer (CC) is the most common malignant tumor in gynecology, and metastasis is an important cause of patient death. MiRNAs (microRNAs) have been found to play key roles in cervical cancer metastasis, but the effect of miR-362-3p in CC
Shuya Yang et al.
Cancer medicine, 10(1), 305-316 (2020-11-20)
BAP31 (B-cell receptor-associated protein 31) is an important regulator of intracellular signal transduction and highly expressed in several cancer tissues or testicular tissues. Our previous study had revealed that elevated BAP31 plays a crucial role in the progress and metastasis
Takushi Namba
Science advances, 5(6), eaaw1386-eaaw1386 (2019-06-18)
The endoplasmic reticulum (ER) is composed of large membrane-bound compartments, and its membrane subdomain appears to be in close contact with mitochondria via ER-mitochondria contact sites. Here, I demonstrate that the ER membrane protein, BAP31, acts as a key factor
Won-Tae Kim et al.
Stem cells (Dayton, Ohio), 32(10), 2626-2641 (2014-06-06)
B-Cell receptor-associated protein 31 (BAP31) regulates the export of secreted membrane proteins from the endoplasmic reticulum (ER) to the downstream secretory pathway. Previously, we generated a monoclonal antibody 297-D4 against the surface molecule on undifferentiated human embryonic stem cells (hESCs).

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico