Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

Ver Toda la documentación

EHU016971

Sigma-Aldrich

MISSION® esiRNA

targeting human MMP2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTGGCAGTGCAATACCTGAACACCTTCTATGGCTGCCCCAAGGAGAGCTGCAACCTGTTTGTGCTGAAGGACACACTAAAGAAGATGCAGAAGTTCTTTGGACTGCCCCAGACAGGTGATCTTGACCAGAATACCATCGAGACCATGCGGAAGCCACGCTGCGGCAACCCAGATGTGGCCAACTACAACTTCTTCCCTCGCAAGCCCAAGTGGGACAAGAACCAGATCACATACAGGATCATTGGCTACACACCTGATCTGGACCCAGAGACAGTGGATGATGCCTTTGCTCGTGCCTTCCAAGTCTGGAGCGATGTGACCCCACTGCGGTTTTCTCGAATCCATGATGGAGAGGCAGACATCATGATCAACTTTGGCCGCTGGGAGCATGGCGATGGATACCCCTTTGACGGTAAGGACGGACTC

Ensembl | nº de acceso humano

ENSG00000087245

Nº de acceso NCBI

NM_004530

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... MMP2(4313) , MMP2(4313)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
LAV
FSU
LRU
NAS
EAS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yonghao Gu et al.
Ophthalmic research, 55(2), 70-75 (2015-11-28)
Proliferative retinal angiogenesis may severely impair the retina. Previous studies have indicated that matrix metalloproteinase (MMP)-2 and MMP-9 play important roles in the process of retinal angiogenesis. In this study, we suppressed MMP-2 and MMP-9 expression with RNA interference (RNAi)
Xi Cheng et al.
Scientific reports, 7(1), 12362-12362 (2017-09-30)
Studies indicate that the chemokine receptor is responsible for poor prognosis of hepatocellular carcinoma (HCC) patients. In this study, we initially demonstrated that CCR4 is overexpressed in HCC specimens, and its elevation in HCC tissues positively correlates with tumor capsule
Qiong Pan et al.
Placenta, 53, 48-53 (2017-05-11)
Preeclampsia (PE) is a serious pregnancy-related syndrome, which is characterized by gestational hypertension and proteinuria. The microRNA-93 (miR-93) is upregulated in the maternal plasma of patients with PE. However, the functional role of miR-93 in PE remains unknown. Here, we
Huaping Zhao et al.
Life sciences, 256, 117897-117897 (2020-06-06)
Glioma is the most common brain malignancy and surgical resection is the primary option for patient with glioma. Anesthetics could be used to inhibit cancer dissemination and metastasis during surgery. This study aims to assess the function of volatile anesthetic
Tingting Ren et al.
American journal of translational research, 9(6), 2824-2837 (2017-07-04)
Human malignant hepatocellular carcinoma (HCC) is a common tumor, which severely threatens human health and shortens longevity. The poor prognosis of HCC is primarily attributed to distant metastases. C-X-C motif chemokine 10 (CXCL10) regulates the control of several cellular and
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico