Todas las fotos(1)

Documentos clave

Certificado de origen (COO)/COA

Ver Toda la documentación

EHU016751

MISSION^® esiRNA

Name: MISSION<SUP>®</SUP> esiRNA
Brand: SIGMA

targeting human CTGF

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Todas las fotos(1)

About This Item

Código UNSPSC:

41105324

NACRES:

NA.51

descripción

Nivel de calidad

100

Línea del producto

MISSION^®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTGCACCAGCATGAAGACATACCGAGCTAAATTCTGTGGAGTATGTACCGACGGCCGATGCTGCACCCCCCACAGAACCACCACCCTGCCGGTGGAGTTCAAGTGCCCTGACGGCGAGGTCATGAAGAAGAACATGATGTTCATCAAGACCTGTGCCTGCCATTACAACTGTCCCGGAGACAATGACATCTTTGAATCGCTGTACTACAGGAAGATGTACGGAGACATGGCATGAAGCCAGAGAGTGAGAGACATTAACTCATTAGACTGGAACTTGAACTGATTCACATCTCATTTTTCCGTAAAAATGATTTCAGTAGCACAAGTTATTTAAATCTGTTTTTCTAACTGGGGGAAAAGATTCCCACCCAATTCAAAACATTGTGCCATGTCAAACAAATAGTCTATCAACCCCAGACACTGGTTTGAAGAATGTTAAGACTTGACAGTGGAACTACATTAGTACACAGCACCAGAATGTATATTAAGGTGTGGCTTTAGGAGCA

Ensembl | nº de acceso humano

ENSG00000118523

Nº de acceso NCBI

NM_001901

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CTGF(1490) , CTGF(1490)

Categorías relacionadas

MISSION® esiRNA

Oligos, qPCR Probes & Peptides

Descripción general

MISSION^® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Loss of expression of protein phosphatase magnesium-dependent 1A during kidney injury promotes fibrotic maladaptive repair.

Rohan Samarakoon et al.

FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 30(10), 3308-3320 (2016-06-23)

Protein phosphatase magnesium-dependent-1A (PPM1A) dephosphorylates SMAD2/3, which suppresses TGF-β signaling in keratinocytes and during Xenopus development; however, potential involvement of PPM1A in chronic kidney disease is unknown. PPM1A expression was dramatically decreased in the tubulointerstitium in obstructive and aristolochic acid

Connective tissue growth factor mediates TGF-β1-induced low-grade serous ovarian tumor cell apoptosis.

Jung-Chien Cheng et al.

Oncotarget, 8(49), 85224-85233 (2017-11-22)

Ovarian low-grade serous carcinoma (LGSC) is a rare disease and is now considered to be a distinct entity from high-grade serous carcinoma (HGSC), which is the most common and malignant form of epithelial ovarian cancer. Connective tissue growth factor (CTGF)

Connective tissue growth factor is correlated with peritoneal lymphangiogenesis.

Hiroshi Kinashi et al.

Scientific reports, 9(1), 12175-12175 (2019-08-23)

Lymphatic absorption in the peritoneal cavity may contribute to ultrafiltration failure in peritoneal dialysis (PD). Lymphatic vessels develop during PD-related peritoneal fibrosis. Connective tissue growth factor (CTGF, also called CCN2) is an important determinant of fibrotic tissue remodeling, but little

CTGF enhances resistance to 5-FU-mediating cell apoptosis through FAK/MEK/ERK signal pathway in colorectal cancer.

Kai Yang et al.

OncoTargets and therapy, 9, 7285-7295 (2016-12-13)

Colorectal cancer (CRC) is one of the most commonly diagnosed cancers among both males and females; the chemotherapy drug 5-fluorouracil (5-FU) is one of a doctors' first lines of defense against CRC. However, therapeutic failures are common because of the

Connective tissue growth factor promotes temozolomide resistance in glioblastoma through TGF-β1-dependent activation of Smad/ERK signaling.

Huijun Zeng et al.

Cell death & disease, 8(6), e2885-e2885 (2017-06-16)

Limited benefits and clinical utility of temozolomide (TMZ) for glioblastoma (GB) are frequently compromised by the development of acquired drug resistance. Overcoming TMZ resistance and uncovering the underlying mechanisms are challenges faced during GB chemotherapy. In this study, we reported

Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico