Saltar al contenido
MilliporeSigma

EHU015931

Sigma-Aldrich

MISSION® esiRNA

targeting human CARD10

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GATCCTTCAGCAGCATGTCAGACATCACAGGGAGTGTGACACTTAAGCCCTGGTCCCCTGGCCTCTCTTCGTCCTCATCCTCTGACAGCGTGTGGCCTTTGGGAAAGCCGGAAGGCCTCCTGGCTCGGGGCTGTGGCCTGGACTTCCTCAACAGGTCTCTGGCTATTCGGGTGTCTGGCCGGAGCCCCCCAGGGGGCCCAGAGCCGCAGGACAAGGGACCAGATGGACTGTCGTTTTATGGGGACAGATGGTCTGGGGCTGTGGTGCGCAGGGTGCTGTCTGGGCCTGGGTCCGCCAGGATGGAACCAAGAGAGCAAAGGGTGGAAGCTGCTGGTCTGGAGGGGGCGTGCCTGGAAGCCGAGGCCCAGCAGAGAACCTTGCTCTGGAATCAGGGGTCCACACTCCCCTCCCTGATGGACTCGAAGGCCTGCCAGTCCTTCCACGAGGCCCTAGAAGCCTGGGCAAAGGGACCAGGTGCCGAGCCCTTCTACATTCGTGCCAACCTCA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Pavithra Shyamsunder et al.
Haematologica, 103(8), 1269-1277 (2018-05-19)
Maturation of granulocytes is dependent on controlled gene expression by myeloid lineage restricted transcription factors. CEBPE is one of the essential transcription factors required for granulocytic differentiation. Identification of downstream targets of CEBPE is vital to understand better its role
Benjamin Causton et al.
Journal of immunology (Baltimore, Md. : 1950), 195(2), 683-694 (2015-06-05)
Innate immune responses to allergens by airway epithelial cells (AECs) help initiate and propagate the adaptive immune response associated with allergic airway inflammation in asthma. Activation of the transcription factor NF-κB in AECs by allergens or secondary mediators via G
Cheng-Shyuan Rau et al.
Toxicological sciences : an official journal of the Society of Toxicology, 140(2), 315-326 (2014-05-28)
This aim of this study was to explore the role of miRNA-146a (miR-146a) and its target genes in endothelial cells. We demonstrated that lipopolysaccharide (LPS) induced the upregulation of miR-146a in human umbilical vein endothelial cells (HUVECs), and that the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico