Saltar al contenido
MilliporeSigma

EHU013491

Sigma-Aldrich

MISSION® esiRNA

targeting human HSF2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AAGCCAAGGGAGAGGATTTCAGATGACATCATTATTTATGATGTTACTGATGATAATGCAGATGAAGAAAATATCCCAGTTATTCCAGAAACTAATGAGGATGTTATATCTGATCCCTCCAACTGTAGCCAGTACCCTGATATTGTCATCGTTGAAGATGACAATGAAGATGAGTATGCACCTGTCATTCAGAGTGGAGAGCAGAATGAACCAGCCAGAGAATCCCTAAGTTCAGGCAGTGATGGCAGCAGCCCTCTCATGTCTAGTGCTGTCCAGCTAAATGGCTCATCCAGTCTGACCTCAGAAGATCCAGTGACCATGATGGATTCCATTTTGAATGATAACATCAATCTTTTGGGAAAGGTTGAGCTGTTGGATTATCTTGACAGTATTGACTGCAGTTTAGAGGACTTCCAGGCCATGCTATCA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yunling Wen et al.
Scandinavian journal of gastroenterology, 55(6), 677-686 (2020-06-17)
Background: Mucosal healing(MH) is a treatment goal in ulcerative colitis (UC). Our previous studies showed heat shock transcription factor 2 (HSF2) was positively correlated with the activity of UC and had anti-inflammatory potential in DSS-induced colitis, but the role of
Jenny Joutsen et al.
Cell reports, 30(2), 583-597 (2020-01-16)
Maintenance of protein homeostasis, through inducible expression of molecular chaperones, is essential for cell survival under protein-damaging conditions. The expression and DNA-binding activity of heat shock factor 2 (HSF2), a member of the heat shock transcription factor family, increase upon

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico