Saltar al contenido
MilliporeSigma

EHU012341

Sigma-Aldrich

MISSION® esiRNA

targeting human CXCL5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTCCAAGGTGGAAGTGGTAGCCTCCCTGAAGAACGGGAAGGAAATTTGTCTTGATCCAGAAGCCCCTTTTCTAAAGAAAGTCATCCAGAAAATTTTGGACGGTGGAAACAAGGAAAACTGATTAAGAGAAATGAGCACGCATGGAAAAGTTTCCCAGTCTTCAGCAGAGAAGTTTTCTGGAGGTCTCTGAACCCAGGGAAGACAAGAAGGAAAGATTTTGTTGTTGTTTGTTTATTTGTTTTTCCAGTAGTTAGCTTTCTTCCTGGATTCCTCACTTTGAAGAGTGTGAGGAAAACCTATGTTTGCCGCTTAAGCTTTCAGCTCAGCTAATGAAGTGTTTAGCATAGTACCTCTGCTATTTGCTGTTATTTTATCTGCTATGCTATTGAAGTTTTGGCAATTGACTATAGTGTGAGCCAGGAATCACTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hongsheng Dang et al.
Oncology research, 25(2), 177-186 (2017-03-10)
CXCL5, a CXC-type chemokine, is an important attractant for granulocytic immune cells by binding to its receptor CXCR2. Recently, CXCL5/CXCR2 has been found to play an oncogenic role in many human cancers. However, the exact role of CXCL5 in osteosarcoma
Zhijie Dai et al.
Oncology reports, 36(6), 3303-3310 (2016-10-18)
CXCL5 and its receptor CXCR2 have been found to be involved in tumorigenesis and cancer progression. Recent studies have shown that CXCR2 is upregulated in glioma tissues, and associated with poor prognosis and recurrence. However, the role of CXCL5/CXCR2 signaling in
Toshiyuki Mitsuyama et al.
Pancreatology : official journal of the International Association of Pancreatology (IAP) ... [et al.], 15(3), 271-280 (2015-03-31)
Characteristics of type 2 autoimmune pancreatitis (AIP) is granulocyte epithelial lesions, called idiopathic duct-centric pancreatitis (IDCP). To clarify pathogenesis of IDCP, we investigated mechanism of neutrophil infiltration in type 1 AIP, called lymphoplasmacytic sclerosing pancreatitis (LPSP) and IDCP. This study

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico