Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

Ver Toda la documentación

EHU012331

Sigma-Aldrich

MISSION® esiRNA

targeting human KIF20A

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACAAGCAGCAGGTTCCATCTGAGGACAGTATGGAGAAGGTGAAAGTATACTTGAGGGTTAGGCCCTTGTTACCTTCAGAGTTGGAACGACAGGAAGATCAGGGTTGTGTCCGTATTGAGAATGTGGAGACCCTTGTTCTACAAGCACCCAAGGACTCTTTTGCCCTGAAGAGCAATGAACGGGGAATTGGCCAAGCCACACACAGGTTCACCTTTTCCCAGATCTTTGGGCCAGAAGTGGGACAGGCATCCTTCTTCAACCTAACTGTGAAGGAGATGGTAAAGGATGTACTCAAAGGGCAGAACTGGCTCATCTATACATATGGAGTCACTAACTCAGGGAAAACCCACACGATTCAAGGTACCATCAAGGATGGAGGGATTCTCCCCCGGTCCCTGGCGCTGATCTTCAATAGCCTCCAAGGCCAACT

Ensembl | nº de acceso humano

ENSG00000112984

Nº de acceso NCBI

NM_005733

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... KIF20A(10112) , KIF20A(10112)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Stéphanie Miserey-Lenkei et al.
Nature communications, 8(1), 1254-1254 (2017-11-03)
The actin and microtubule cytoskeletons play important roles in Golgi structure and function, but how they are connected remain poorly known. In this study, we investigated whether RAB6 GTPase, a Golgi-associated RAB involved in the regulation of several transport steps
Daniela Stangel et al.
The Journal of surgical research, 197(1), 91-100 (2015-05-09)
The Translational Genome Research Network in Pancreatic Cancer performed a meta-analysis of publicly available various high-throughput gene analysis panels to identify drugable targets. There, the most differentially expressed gene between normal and cancerous pancreas was Kif20a. The aim of the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico