Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

View All Documentation

EHU008751

Sigma-Aldrich

MISSION® esiRNA

targeting human EPAS1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGCCAGGTGAAAGTCTACAACAACTGCCCTCCTCACAATAGTCTGTGTGGCTACAAGGAGCCCCTGCTGTCCTGCCTCATCATCATGTGTGAACCAATCCAGCACCCATCCCACATGGACATCCCCCTGGATAGCAAGACCTTCCTGAGCCGCCACAGCATGGACATGAAGTTCACCTACTGTGATGACAGAATCACAGAACTGATTGGTTACCACCCTGAGGAGCTGCTTGGCCGCTCAGCCTATGAATTCTACCATGCGCTAGACTCCGAGAACATGACCAAGAGTCACCAGAACTTGTGCACCAAGGGTCAGGTAGTAAGTGGCCAGTACCGGATGCTCGCAAAGCATGGGGGCTACGTGTGGCTGGAGACCCAGGGGACGGTCATCTACAACCCTCGCAACCTGCAGCCCCAGTGCATCATGTGTGTCA

Ensembl | human accession no.

ENSG00000116016

NCBI accession no.

NM_001430

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... EPAS1(2034) , EPAS1(2034)

Categorías relacionadas

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Seungyeul Yoo et al.
PLoS genetics, 11(1), e1004898-e1004898 (2015-01-09)
Chronic Obstructive Pulmonary Disease (COPD) is a complex disease. Genetic, epigenetic, and environmental factors are known to contribute to COPD risk and disease progression. Therefore we developed a systematic approach to identify key regulators of COPD that integrates genome-wide DNA
Kei Houri et al.
Scientific reports, 10(1), 3735-3735 (2020-03-01)
Elevation of the levels of reactive oxygen species (ROS) is a major tissue-degenerative phenomenon involved in aging and aging-related diseases. The detailed mechanisms underlying aging-related ROS generation remain unclear. Presently, the expression of microRNA (miR)-142-5p was significantly upregulated in bone
Olga Roche et al.
Nucleic acids research, 44(19), 9315-9330 (2016-11-02)
A wide range of diseases course with an unbalance between the consumption of oxygen by tissues and its supply. This situation triggers a transcriptional response, mediated by the hypoxia inducible factors (HIFs), that aims to restore oxygen homeostasis. Little is
Farhadul Islam et al.
Frontiers in oncology, 10, 1534-1534 (2020-10-13)
Endothelial PAS domain-containing protein 1 (EPAS1) is an angiogenic factor and its implications have been reported in many cancers but not in esophageal squamous cell carcinoma (ESCC). Herein, we aim to examine the genetic and molecular alterations, clinical implications, and
Shirley Dehn et al.
Journal of immunology (Baltimore, Md. : 1950), 197(9), 3639-3649 (2016-09-28)
Hypoxia-inducible factor (HIF)-α isoforms regulate key macrophage (MΦ) functions during ischemic inflammation. HIF-2α drives proinflammatory cytokine production; however, the requirements for HIF-2α during other key MΦ functions, including phagocytosis, are unknown. In contrast to HIF-1α, HIF-2α was not required for
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico