Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

Ver Toda la documentación

EHU008491

Sigma-Aldrich

MISSION® esiRNA

targeting human IL33

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTTGCTTTGGAGGATGAAAGTTATGAGATATATGTTGAAGACTTGAAAAAAGATGAAAAGAAAGATAAGGTGTTACTGAGTTACTATGAGTCTCAACACCCCTCAAATGAATCAGGTGACGGTGTTGATGGTAAGATGTTAATGGTAACCCTGAGTCCTACAAAAGACTTCTGGTTGCATGCCAACAACAAGGAACACTCTGTGGAGCTCCATAAGTGTGAAAAACCACTGCCAGACCAGGCCTTCTTTGTCCTTCATAATATGCACTCCAACTGTGTTTCATTTGAATGCAAGACTGATCCTGGAGTGTTTATAGGTGTAAAGGATAATCATCTTGCTCTGATTAAAGTAGACTCTTCTGAGAATTTGTGTACTGAAAATATCTTGTTTAAGCTCTCTGAAACTTAGTTGATGGAAACCTGTGAGTCTTGGG

Ensembl | human accession no.

ENSG00000137033

NCBI accession no.

NM_033439

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... IL33(90865) , IL33(90865)

Categorías relacionadas

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
LAV

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Dongmin Shao et al.
Biochemical and biophysical research communications, 451(1), 8-14 (2014-07-09)
Idiopathic pulmonary arterial hypertension (IPAH) is an incurable condition leading to right ventricular failure and death and inflammation is postulated to be associated with vascular remodelling. Interleukin (IL)-33, a member of the "alarmin" family can either act on the membrane
Haiyan Hu et al.
Biochemical and biophysical research communications, 485(3), 643-650 (2017-02-22)
Breast cancers with estrogen receptor (ER) expressions account for the majority of all clinical cases. Due to hormone therapy with tamoxifen, prognoses of patients with ER-positive breast cancer are significantly improved. However, endocrine resistance to tamoxifen is common and inevitable
Meng Li et al.
International journal of molecular sciences, 22(5) (2021-03-07)
Short-chain fatty acids (e.g., butyrate and propionate) are able to diminish endothelial cell activation. The aim of this study was to investigate whether intracellular IL-33 mediates the effects of butyrate and propionate on TNFα-induced IL-8 production and vascular cell adhesion
Weronika Gonciarz et al.
International journal of molecular sciences, 21(5) (2020-03-11)
Interleukin (IL)-33 is a proinflammatory mediator that alerts the host immune system to disorders in tissue homeostasis. Aim. To understand the role of IL-33 in modulating gastric tissue cell growth affected by Helicobacter pylori (H. pylori). Methods. IL-33 production in
Supaporn Yangngam et al.
Journal of Cancer, 11(22), 6571-6581 (2020-10-14)
Interleukin 33 (IL-33) promotes cholangiocarcinoma (CCA) genesis in a mouse model, however, its function in human CCA has not been clearly understood. This study was aimed to investigate IL-33 level in CCA tissues and its clinicopathological correlations. The results revealed
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico