Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

Ver Toda la documentación

EHU007981

Sigma-Aldrich

MISSION® esiRNA

targeting human ALOX12

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CACCAAGGAAGATGTGACGATGGCCACAGTGATGGGGTCACTACCTGATGTCCGGCAGGCCTGTCTTCAAATGGCCATCTCATGGCATCTGAGTCGCCGCCAGCCAGACATGGTGCCTCTGGGGCACCACAAAGAAAAATATTTCTCAGGCCCCAAGCCCAAAGCTGTGCTAAACCAATTCCGAACAGATTTGGAAAAGCTGGAAAAGGAGATTACAGCCCGGAATGAGCAACTTGACTGGCCCTATGAATATCTGAAGCCCAGCTGCATAGAGAACAGTGTCACCATCTGAGCCCTAGAGTGACTCTACCTGCAAGATTTCACATCAGCTTTAGGACTGACATTTCTATCTTGAATTTCATGCTTTCCTAAAGTCTCTGCTGCTAAGGCTCTATTTCCTCCCCCAGTTAAACCCCCTACATTAGTATCCCACTAGCCCAGGGGAGCAGTAAACTTTCTCTGCAAAGACTAGATCCTTTTTTACGCTTTGCAGACCGCATAGTCACTGTCTCAACTACTCAGCTCTCCTGCTGCA

Ensembl | nº de acceso humano

ENSG00000108839

Nº de acceso NCBI

NM_000697

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ALOX12(239) , ALOX12(239)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

William H Witola et al.
Infection and immunity, 82(7), 2670-2679 (2014-04-02)
ALOX12 is a gene encoding arachidonate 12-lipoxygenase (12-LOX), a member of a nonheme lipoxygenase family of dioxygenases. ALOX12 catalyzes the addition of oxygen to arachidonic acid, producing 12-hydroperoxyeicosatetraenoic acid (12-HPETE), which can be reduced to the eicosanoid 12-HETE (12-hydroxyeicosatetraenoic acid).
Ji-Li Li et al.
Biochemical and biophysical research communications, 516(3), 991-998 (2019-07-07)
Spinal cord injury (SCI) is terrible damage leading to the deficiencies and results in infinite inconvenience to sufferers. The effective treatment for SCI still meets a larger number of problems. Herein, the underlying molecular mechanism and novel therapy of SCI
Zhen Huang et al.
Biochemical and biophysical research communications, 514(1), 24-30 (2019-04-25)
Arachidonate lipoxygenase12 (Alox12) and its metabolites 12S-hydroxyeicosatetraenoic acid (12S-HETE) have been implicated in influencing tumor transformation and progression. In this study, we have systematically evaluated the expression, function and the downstream effectors of Alox12 in breast cancer using loss- and

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico