Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

Ver Toda la documentación

EHU006581

Sigma-Aldrich

MISSION® esiRNA

targeting human SUFU

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGCTTTGAGTTGACCTTTCGTCTGAAGAGAGAAACTGGGGAGTCTGCCCCACCAACATGGCCCGCAGAGTTAATGCAGGGCTTGGCACGATACGTGTTCCAGTCAGAGAACACCTTCTGCAGTGGGGACCATGTGTCCTGGCACAGCCCTTTGGATAACAGTGAGTCAAGAATTCAGCACATGCTGCTGACAGAGGACCCACAGATGCAGCCCGTGCAGACACCCTTTGGGGTAGTTACCTTCCTCCAGATCGTTGGTGTCTGCACTGAAGAGCTACACTCAGCCCAGCAGTGGAACGGGCAGGGCATCCTGGAGCTGCTGCGGACAGTGCCTATTGCTGGCGGCCCCTGGCTGATAACTGACATGCGGAGGGGAGAGACCATATTTGAGATCGATCCACACCTGCAAGAGAGAGTTGACAAAGGCATCGAGACAG

Ensembl | nº de acceso humano

ENSG00000107882

Nº de acceso NCBI

NM_016169

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... SUFU(51684) , SUFU(51684)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
LSS
JRR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yin Peng et al.
Cell cycle (Georgetown, Tex.), 19(20), 2720-2733 (2020-10-06)
The poor prognosis of late gastric carcinomas (GC) underscores the necessity to identify novel biomarkers for earlier diagnosis and effective therapeutic targets. MiRNA-324-5p has been shown to be over-expressed in GC, however the biological function of miRNA-324-5p implicated in gastric
Yin Peng et al.
Cancer letters, 385, 117-127 (2016-11-05)
Emerging evidence has shown that miRNA-194 is aberrantly upregulated in gastric cancer (GC); however, the biological mechanisms underlying its involvement are largely unknown. Wnt/β-catenin signaling has been implicated in gastric tumorigenesis; we therefore hypothesized that miRNA-194 promotes gastric carcinogenesis by
Bo Ram Kim et al.
Cell death and differentiation, 27(2), 676-694 (2019-07-07)
Disabled tumor suppressor genes and hyperactive oncogenes greatly contribute to cell fates during cancer development because of their genetic alterations such as somatic mutations. However, little is known about how tumor suppressor genes react to diverse oncogenes during tumor progression.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico