Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

Ver Toda la documentación

EHU004421

Sigma-Aldrich

MISSION® esiRNA

targeting human BMI1, COMMD3-BMI1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
$220.00
50 μG
$391.00

$220.00

Normalmente se envía en 1 semana. (Para pedidos fuera de Estados Unidos y Europa, calcule la entrega 1 o 2 semanas más tarde)
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
$220.00
50 μG
$391.00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

$220.00

Normalmente se envía en 1 semana. (Para pedidos fuera de Estados Unidos y Europa, calcule la entrega 1 o 2 semanas más tarde)

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCATCCTTCTGCTGATGCTGCCAATGGCTCTAATGAAGATAGAGGAGAGGTTGCAGATGAAGATAAGAGAATTATAACTGATGATGAGATAATAAGCTTATCCATTGAATTCTTTGACCAGAACAGATTGGATCGGAAAGTAAACAAAGACAAAGAGAAATCTAAGGAGGAGGTGAATGATAAAAGATACTTACGATGCCCAGCAGCAATGACTGTGATGCACTTAAGAAAGTTTCTCAGAAGTAAAATGGACATACCTAATACTTTCCAGATTGATGTCATGTATGAGGAGGAACCTTTAAAGGATTATTATACACTAATGGATATTGCCTACATTTATACCTGGAGAAGGAATGGTCCACTTCCATTGAAATACAGAGTTCGACCTACTTGTAAAAGAATGAAGATCAGTCACCAGAGAGATGGACTGACAAATGCTGGAGAACTGGAAAGTGACTCTGGGAGTGACAAGGCCAACAGCCCAGCAGGAGGTATTCCCTCCACCTCTTCTTGTTTGCCTAGCCCCAGTACTCCAGTGCAGTCTCCTCATCCA

Ensembl | nº de acceso humano

ENSG00000168283

Nº de acceso NCBI

NM_005180

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... BMI1(100532731) , BMI1(648)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
OWU
AQT
AAT
DHT
JBS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Fan Xu et al.
Experimental and therapeutic medicine, 14(3), 2216-2220 (2017-10-01)
The protective effects and mechanisms of esculetin on doxorubicin (DOX)-induced injury of H9c2 cells were investigated. H9c2 cells were cultured and the logarithmic growth phase of the cells was divided into a control group, a DOX group and an esculetin
M Hiraki et al.
Oncogene, 36(20), 2791-2801 (2016-11-29)
B-cell-specific Moloney murine leukemia virus integration site 1 (BMI1) is a component of the polycomb repressive complex 1 (PRC1) complex that is overexpressed in breast and other cancers, and promotes self-renewal of cancer stem-like cells. The oncogenic mucin 1 (MUC1)
M H Shahi et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 37(11), 15107-15114 (2016-09-25)
Chemoresistance is a common hurdle for the proper treatment of gliomas. The role of Shh-Gli1 signaling in glioma progression has been reported. However, its role in glioma chemoresistance has not been well studied yet. In this work, we found that
Reigetsu Yoshikawa et al.
BMC cancer, 12, 461-461 (2012-10-11)
The polycomb group (PcG) family BMI1, acting downstream of the hedgehog (Hh) pathway, plays an essential role in the self-renewal of haematopoietic, neural, and intestinal stem cells, and is dysregulated in many types of cancer. Our recent report has demonstrated
Hexiang Wang et al.
Biochemical and biophysical research communications, 537, 22-28 (2021-01-01)
Triple-negative breast cancer (TNBC) is a major challenge in clinical practice due to its aggressiveness and lack of targeted treatment. Cancer stem-like traits contribute to tumorigenesis and immune privilege of TNBC. However, the relationship of stemness and immunosurveillance remains unclear.
Ver todos los artículos relacionados

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico