Saltar al contenido
MilliporeSigma

EHU004281

Sigma-Aldrich

MISSION® esiRNA

targeting human IDH2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCCCATCATCTGCAAAAACATCCCACGCCTAGTCCCTGGCTGGACCAAGCCCATCACCATTGGCAGGCACGCCCATGGCGACCAGTACAAGGCCACAGACTTTGTGGCAGACCGGGCCGGCACTTTCAAAATGGTCTTCACCCCAAAAGATGGCAGTGGTGTCAAGGAGTGGGAAGTGTACAACTTCCCCGCAGGCGGCGTGGGCATGGGCATGTACAACACCGACGAGTCCATCTCAGGTTTTGCGCACAGCTGCTTCCAGTATGCCATCCAGAAGAAATGGCCGCTGTACATGAGCACCAAGAACACCATACTGAAAGCCTACGATGGGCGTTTCAAGGACATCTTCCAGGAGATCTTTGACAAGCACTATAAGACCGACTTCGACAAGAATAAGATCTGGTATGAGCACCGGCTCATTGATGACATGGTGGCTCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Bonnie H Y Yeung et al.
American journal of respiratory cell and molecular biology, 63(1), 36-45 (2020-03-10)
Global DNA hydroxymethylation mediated by the TET (ten-eleven translocation) enzyme was induced in allergen-induced airway hyperresponsiveness in mouse lung tissues and specifically in isolated airway smooth muscle (ASM) cells. TET is an α-ketoglutarate (α-KG)-dependent enzyme, and the production of α-KG
Fen Gong et al.
Biochemical and biophysical research communications, 514(3), 593-600 (2019-05-09)
Nonalcoholic fatty liver disease (NAFLD) has become an epidemic across the world. A large and growing unmet therapeutic requirement has inspired plenty exploration in the field. Isocitrate dehydrogenase 2 (IDH2), localized in mitochondria, decreases NADP+ to NADPH during the decarboxylation
Su-Jeong Choi et al.
Biochemical and biophysical research communications, 503(3), 1805-1811 (2018-08-04)
Isocitrate dehydrogenase 2 (IDH2) is an essential enzyme in the mitochondrial antioxidant system, which produces nicotinamide adenine dinucleotide phosphate, and thereby defends against oxidative stress. We have shown that IDH2 downregulation results in mitochondrial dysfunction and reactive oxygen species (ROS)

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico