Saltar al contenido
MilliporeSigma
Get 22% off for Pi Day through March 31.Save Now

EHU003641

MISSION® esiRNA

targeting human PGRMC1

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCTGGATAAGGAAGCACTGAAGGATGAGTACGATGACCTTTCTGACCTCACTGCTGCCCAGCAGGAGACTCTGAGTGACTGGGAGTCTCAGTTCACTTTCAAGTATCATCACGTGGGCAAACTGCTGAAGGAGGGGGAGGAGCCCACTGTGTACTCAGATGAGGAAGAACCAAAAGATGAGAGTGCCCGGAAAAATGATTAAAGCATTCAGTGGAAGTATATCTATTTTTGTATTTTGCAAAATCATTTGTAACAGTCCACTCTGTCTTTAAAACATAGTGATTACAATATTTAGAAAGTTTTGAGCACTTGCTATAAGTTTTTTAATTAACATCACTAGTGACACTAATAAAATTAACTTCTTAGAATGCATGATGTGTTTGTGTGTCACAAATCCAGAAAGTGAACTGCAGTGCTGTAATACACATGTTAATACTGTTTTTCTTCTATCTGTAGTTAGTACAGGATGAATTTAAATGTGTTTTTCCTGAGAGACAAGGAAGACTTGGGTATTTCCCAAAACAGGTAAAAATCTTAAATGTGCACCAAGAGCAAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PGRMC1(10857)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Diego A Pedroza et al.
British journal of cancer, 123(8), 1326-1335 (2020-07-25)
Increased expression of the progesterone receptor membrane component 1 (PGRMC1) has been linked to multiple cancers, including breast cancer. Despite being a regulatory receptor and a potential therapeutic target, the oncogenic potential of PGRMC1 has not been studied. The impact
Domenica Roberto et al.
The Prostate, 79(15), 1777-1788 (2019-09-11)
Gleason grade is among the most powerful clinicopathological classification systems used to assess risk of lethal potential in prostate cancer, yet its biologic basis is poorly understood. Notably, pure low-grade cancers, comprised predominantly of Gleason pattern 3 (G3) are typically
Ying Lin et al.
Scientific reports, 10(1), 4748-4748 (2020-03-18)
In non-small-cell lung cancer, mutation of epidermal growth factor receptor (EGFR) stimulates cell proliferation and survival. EGFR tyrosine kinase inhibitors (EGFR-TKIs) such as erlotinib are used as first-line therapy with drastic and immediate effectiveness. However, the disease eventually progresses in

Contenido relacionado

Instructions

Número de artículo de comercio global

SKUGTIN
EHU003641-50UG04061828443987
EHU003641-20UG04061831360400

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico