Saltar al contenido
MilliporeSigma

EHU002981

Sigma-Aldrich

MISSION® esiRNA

targeting human KIF3A

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGCTGTCAGTGTGGATGAGATGAGGGGAACTATCACTGTACATAAGACTGATTCTTCCAATGAACCTCCAAAGACATTTACTTTTGATACTGTTTTTGGACCAGAGAGTAAACAACTTGATGTTTATAACTTAACTGCAAGACCTATTATTGATTCTGTACTTGAAGGCTACAATGGGACTATTTTTGCATATGGACAAACCGGAACAGGCAAAACTTTTACCATGGAAGGTGTTCGAGCTATTCCTGAACTTAGAGGAATAATTCCCAATTCATTTGCTCACATATTTGGTCATATTGCAAAAGCGGAGGGTGATACAAGATTTTTGGTTCGAGTGTCTTATTTGGAAATATATAATGAAGAAGTTCGTGACCTTTTGGGCAAGGATCAGACACAAAGGTTAGAGGTTAAAGAAAGACCTGATGTGGGAGTTTATATCAAAGATTTATCAGCTTATGTGGTAAATAATGCTGATGATATGGATAGAATTATGACGCTAGGCCACAAAAATCGTTCTGTTGGTGCAACTAATATGAACGAACATAGTTCCCGTTCCCATG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Loren Masterson et al.
Journal of skin cancer, 2014, 596459-596459 (2014-03-19)
Due to the rarity of Merkel cell carcinoma (MCC), prospective clinical trials have not been practical. This study aimed to identify biomarkers with prognostic significance. While sixty-two patients were identified who were treated for MCC at our institution, only seventeen
Premkumar Vummidi Giridhar et al.
Journal of immunology (Baltimore, Md. : 1950), 197(11), 4228-4239 (2016-11-01)
KIF3A, the gene encoding kinesin family member 3A, is a susceptibility gene locus associated with asthma; however, mechanisms by which KIF3A might influence the pathogenesis of the disorder are unknown. In this study, we deleted the mouse Kif3a gene in
Anne-Clémence Vion et al.
The Journal of cell biology, 217(5), 1651-1665 (2018-03-04)
Blood flow shapes vascular networks by orchestrating endothelial cell behavior and function. How endothelial cells read and interpret flow-derived signals is poorly understood. Here, we show that endothelial cells in the developing mouse retina form and use luminal primary cilia
Don-Marc Franchini et al.
Cell reports, 26(1), 94-107 (2019-01-04)
Despite the clinical success of blocking inhibitory immune checkpoint receptors such as programmed cell death-1 (PD-1) in cancer, the mechanisms controlling the expression of these receptors have not been fully elucidated. Here, we identify a post-transcriptional mechanism regulating PD-1 expression

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico