Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

Ver Toda la documentación

EHU002801

Sigma-Aldrich

MISSION® esiRNA

targeting human EPHA3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
$220.00
50 μG
$391.00

$220.00

Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
$220.00
50 μG
$391.00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

$220.00

Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGGTGGACATCACCAGAAGCTATAGCCTACCGCAAGTTCACGTCAGCCAGCGATGTATGGAGTTATGGGATTGTTCTCTGGGAGGTGATGTCTTATGGAGAGAGACCATACTGGGAGATGTCCAATCAGGATGTAATTAAAGCTGTAGATGAGGGCTATCGACTGCCACCCCCCATGGACTGCCCAGCTGCCTTGTATCAGCTGATGCTGGACTGCTGGCAGAAAGACAGGAACAACAGACCCAAGTTTGAGCAGATTGTTAGTATTCTGGACAAGCTTATCCGGAATCCCGGCAGCCTGAAGATCATCACCAGTGCAGCCGCAAGGCCATCAAACCTTCTTCTGGACCAAAGCAATGTGGATATCACTACCTTCCGCACAACAGGTGACTGGCTTAATGGTGTCTGGACAGCACACTGCAAGGAAATCTTCACGGGTGTG

Ensembl | nº de acceso humano

ENSG00000044524

Nº de acceso NCBI

NM_005233

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... EPHA3(2042) , EPHA3(2042)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
ACNV
JUU
NRR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiaole Chen et al.
Molecular cancer research : MCR, 16(5), 909-919 (2018-02-18)
The Hedgehog (Hh) receptor Patched1 (PTCH1) is a well-known tumor suppressor that in its active form represses Smoothened (SMO) activity, inhibits proliferation, and induces apoptosis. The cytoplasmic C-terminal domain (CTD) regulates PTCH1 turnover and nucleates a proapoptotic complex. In this
Maleeha A Qazi et al.
Cancer research, 78(17), 5023-5037 (2018-06-28)
Glioblastoma (GBM) carries a dismal prognosis and inevitably relapses despite aggressive therapy. Many members of the Eph receptor tyrosine kinase (EphR) family are expressed by GBM stem cells (GSC), which have been implicated in resistance to GBM therapy. In this
Song Hee Kim et al.
Cellular signalling, 47, 122-130 (2018-04-14)
Radiotherapy is a well-established therapeutic modality used in the treatment of many cancers. However, radioresistance remains a serious obstacle to successful treatment. Radioresistance can cause local recurrence and distant metastases in some patients after radiation treatment. Thus, many studies have
Hemei Xiao et al.
Cell biology international (2018-04-17)
MicroRNAs (miRNAs) play key roles in cervical cancer metastasis progression. Accumulated evidences have revealed that miRNAs are related to the pathophysiological process. However, the role of miR-340 in cervical cancer and how it works is still not fully interpreted. Using
Antonella Caivano et al.
Oncotarget, 8(21), 34298-34309 (2017-04-19)
This study investigates the role of ephrin receptor A3 (EphA3) in the angiogenesis of Multiple Myeloma (MM) and the effects of a selective target of EphA3 by a specific monoclonal antibody on primary bone marrow endothelial cells (ECs) of MM

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico