Saltar al contenido
MilliporeSigma

EHU001851

Sigma-Aldrich

MISSION® esiRNA

targeting human UBE2O

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGGACAACAACGAGTTCTGCCCTGGAGACTTCGTGGTAGATAAGCGAGTCCAGAGCTGTCCAGACCCTGCTGTCTACGGTGTGGTACAGTCTGGGGACCACATCGGCCGTACCTGCATGGTGAAGTGGTTCAAGCTGAGGCCGAGTGGGGACGACGTGGAGCTGATTGGAGAAGAGGAAGATGTGAGTGTTTACGACATTGCTGACCACCCTGACTTTAGGTTCCGTACAACTGACATCGTCATCCGCATCGGCAATACTGAGGATGGGGCTCCTCACAAGGAGGATGAGCCATCGGTGGGCCAGGTGGCCCGTGTGGACGTCAGCAGCAAGGTGGAGGTGGTGTGGGCTGACAACTCAAAGACCATCATCCTGCCCCAGCACTTGTACAACATAGAGTCTGAGATTGAGGAGTCAGACTACGATTCGGTAGAAGGCAGCAC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Bobin Mi et al.
Journal of nanobiotechnology, 18(1), 68-68 (2020-05-08)
Enhancing angiogenesis is critical for accelerating wound healing. Application of different types of exosomes (Exos) to promote angiogenesis represents a novel strategy for enhanced wound repair. Saliva is known to accelerate wound healing, but the underlying mechanisms remain unclear. Our
Salima Daou et al.
Nature communications, 9(1), 4385-4385 (2018-10-24)
The tumor suppressor and deubiquitinase (DUB) BAP1 and its Drosophila ortholog Calypso assemble DUB complexes with the transcription regulators Additional sex combs-like (ASXL1, ASXL2, ASXL3) and Asx respectively. ASXLs and Asx use their DEUBiquitinase ADaptor (DEUBAD) domain to stimulate BAP1/Calypso

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico