Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos

EHU001391

Sigma-Aldrich

MISSION® esiRNA

targeting human TMEM131

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGTCCAAGGACAAGGAACAACTGAGAACTTGAGGGTGGCAGGCAAGCTTCCAGGTCCAGGAAGCTCCTTACGCTTTAAAATCACGGAAGCATTGTTAAAAGATTGTACAGATAGTTTAAAACTAAGAGAACCAAATTTCACATTGAAAAGAACATTTAAGGTAGAGAATACAGGACAACTTCAAATTCACATAGAAACCATTGAAATCAGTGGATACTCATGTGAAGGATATGGCTTTAAAGTTGTTAATTGTCAAGAGTTTACTCTAAGTGCCAATGCTTCTAGAGATATAATCATATTGTTTACTCCTGATTTTACAGCTTCTAGAGTTATTCGGGAACTGAAGTTTATAACAACCAGTGGCTCTGAGTTTGTATTTATATTGAATGCATCCCTTCCTTACCATATGTTAGCAACCTGTGCAGAAGCCCTACCCAGACCT

Ensembl | human accession no.

ENSG00000075568

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TMEM131(23505) , TMEM131(23505)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Chao Wang et al.
Journal of cellular biochemistry, 119(2), 1646-1658 (2017-08-05)
The study elucidated the effects associated with silencing growth factor-β R1 (TGF-β R1) and TGF-β R2 genes on the proliferation and apoptosis of penile urethral epithelial cells (UECs) in hypospadiac male rats. Seventy-five male rats were distributed into the normal
Karl E Carlström et al.
Nature communications, 11(1), 4071-4071 (2020-08-15)
Arrest of oligodendrocyte (OL) differentiation and remyelination following myelin damage in multiple sclerosis (MS) is associated with neurodegeneration and clinical worsening. We show that Glutathione S-transferase 4α (Gsta4) is highly expressed during adult OL differentiation and that Gsta4 loss impairs
Yanjie Zhang et al.
Ecotoxicology and environmental safety, 179, 222-231 (2019-05-03)
Hydrogen sulfide (H2S), a multifunctional gasotransmitter, participates in a wide range of cellular signal transduction and pathophysiological processes. Cystathionine gamma-lyase (CSE) acts as a major H2S-generating enzyme in peripheral organs and tissues. As a cysteine-rich and heavy metal-binding protein, metallothionein-1
Yanjie Zhang et al.
Antioxidants & redox signaling, 32(9), 583-601 (2019-12-25)
Aims: The physiological and pathological importance of hydrogen sulfide (H2S) as a novel gasotransmitter has been widely recognized. Cystathionine
Shigemi Kimura et al.
Scientific reports, 4, 5066-5066 (2014-06-12)
The ZHTc6-MyoD embryonic stem cell line expresses the myogenic transcriptional factor MyoD under the control of a tetracycline-inducible promoter. Following induction, most of the ZHTc6-MyoD cells differentiate to myotubes. However, a small fraction does not differentiate, instead forming colonies that
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico