Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

Ver Toda la documentación

EHU001241

Sigma-Aldrich

MISSION® esiRNA

targeting human CTSS

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GAAACAAAGGCTGCAATGGTGGCTTCATGACAACGGCTTTCCAGTACATCATTGATAACAAGGGCATCGACTCAGACGCTTCCTATCCCTACAAAGCCATGGATCAGAAATGTCAATATGACTCAAAATATCGTGCTGCCACATGTTCAAAGTACACTGAACTTCCTTATGGCAGAGAAGATGTCCTGAAAGAAGCTGTGGCCAATAAAGGCCCAGTGTCTGTTGGTGTAGATGCGCGTCATCCTTCTTTCTTCCTCTACAGAAGTGGTGTCTACTATGAACCATCCTGTACTCAGAATGTGAATCATGGTGTACTTGTGGTTGGCTATGGTGATCTTAATGGGAAAGAATACTGGCTTGTGAAAAACAGCTGGGGCCACAACTTTGGTGAAGAAGGATATATTCGGATGGCAAGAAATAAAGGAAATCATTGTGGGATTGC

Ensembl | nº de acceso humano

ENSG00000163131

Nº de acceso NCBI

NM_004079

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CTSS(1520) , CTSS(1520)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
BRU

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Chi-Jen Chang et al.
American journal of physiology. Lung cellular and molecular physiology, 317(1), L1-L13 (2019-04-25)
Cysteine cathepsin proteases play critical roles in cardiovascular disease progression and are implicated in extracellular matrix (ECM) degradation. Patients with pulmonary arterial hypertension (PAH) exhibit increased elastase production by pulmonary arterial smooth muscle cells (PASMCs), which is related to the
Ming-Ju Hsieh et al.
Scientific reports, 7, 45039-45039 (2017-03-23)
Oral cancer is one of the most common cancers in the world. Approximately 90% of oral cancers are subtyped to oral squamous cell carcinoma (OSCC). Despite advances in diagnostic techniques and improvement in treatment modalities, the prognosis remains poor. Therefore

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico