Saltar al contenido
MilliporeSigma

EHU001181

Sigma-Aldrich

MISSION® esiRNA

targeting human SOCS2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
$220.00
50 μG
$391.00

$220.00


Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).


Seleccione un Tamaño

Cambiar Vistas
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00


Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTCGCACTGACTTCAAGGAAGGACGCGAACCCTTCTCTGACCCCAGCTCGGGCGGCCACCTGTCTTTGCCGCGGTGACCCTTCTCTCATGACCCTGCGGTGCCTTGAGCCCTCCGGGAATGGCGGGGAAGGGACGCGGAGCCAGTGGGGGACCGCGGGGTCGGCGGAGGAGCCATCCCCGCAGGCGGCGCGTCTGGCGAAGGCCCTGCGGGAGCTCGGTCAGACAGGATGGTACTGGGGAAGTATGACTGTTAATGAAGCCAAAGAGAAATTAAAAGAGGCACCAGAAGGAACTTTCTTGATTAGAGATAGCTCGCATTCAGACTACCTACTAACAATATCTGTTAAAACATCAGCTGGACCAACTAATCTTCGAATCGAATACCAAGACGGAAAATTCAGATTGGACTCTATCATATGTGTCAAATCCAAGCTTAAACAATTTGACAGTGTGGTTCATCTGATCGACTACTATGTTCAGATGTGCAAGGATAAGCGGACAGGTCCAGAAGCCCCCCGGAACGGCACTGTTCACCTTTATCTGACCAAACCGCTCTACACGTCAGCACCATCTCTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Fang Wang et al.
Journal of biomedical science, 28(1), 4-4 (2021-01-06)
Circular RNAs (circRNAs) have caught increasing attentions and interests for their important involvement in cancer initiation and progression. This study aims to investigate the biological functions of circNOL10 and its potential molecular mechanisms in breast cancer (BC). qRT-PCR and western
Jihao Xu et al.
Oncology reports, 44(3), 973-986 (2020-07-25)
N6‑methyladenosine (m6A) RNA modification maintained by N6‑methyltransferases and demethylases is involved in multiple biological functions. Methyltransferase like 3 (METTL3) is a major N6‑methyltransferase. However, the role of METTL3 and its installed m6A modification in colorectal tumorigenesis remains to be fully
Haichun Ouyang et al.
International immunopharmacology, 81, 106204-106204 (2020-02-23)
Accumulating evidence has revealed the roles of microRNAs (miRs) in sepsis, hence, the aim of the present study was to investigate whether miR-208a-5p affects sepsis whilst attempting to elucidate the mechanisms by which the suppressors of cytokine signaling 2 (SOCS2)-mediated

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico