Skip to Content
Merck
All Photos(1)

Key Documents

EMU082841

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nfe2l2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGAGAACATTGTCGAGCTGGAGCAAGACTTGGGCCACTTAAAAGACGAGAGAGAAAAACTACTCAGAGAAAAGGGAGAAAACGACAGAAACCTCCATCTACTGAAAAGGCGGCTCAGCACCTTGTATCTTGAAGTCTTCAGCATGTTACGTGATGAGGATGGAAAGCCTTACTCTCCCAGTGAATACTCTCTGCAGCAAACCAGAGATGGCAATGTGTTCCTTGTTCCCAAAAGCAAGAAGCCAGATACAAAGAAAAACTAGGTTCGGGAGGATGGAGCCTTTTCTGAGCTAGTGTTTGTTTTGTACTGCTAAAACTTCCTACTGTGATGTGAAATGCAGAAACACTTTATAAGTAACTATGCAGAATTATAGCCAAAGCTAGTATAGCAATAATATGAAACTTTACAAAGCATTAAAGTCTCAATGTTGAATCAGTTTCATTTTAACTCTCAAGTTAATTTCTTAGGCACCATTTGGGAG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jian-ping Li et al.
Acta pharmacologica Sinica, 35(8), 1031-1044 (2014-07-01)
To investigate the anti-fibrosis effects of ginsenoside Rg1 on alcohol- and CCl4-induced hepatic fibrosis in rats and to explore the mechanisms of the effects. Rats were given 6% alcohol in water and injected with CCl4 (2 mL/kg, sc) twice a
Jie Zhou et al.
PloS one, 9(7), e101668-e101668 (2014-07-06)
Salvianolic acid B (SalB), a bioactive compound isolated from the plant-derived medicinal herb Danshen, has been shown to exert various anti-oxidative and anti-inflammatory activities in several neurological disorders. In this study, we sought to investigate the potential protective effects and
Amin Haghani et al.
eLife, 9 (2020-06-25)
The neurotoxicity of air pollution is undefined for sex and APOE alleles. These major risk factors of Alzheimer's disease (AD) were examined in mice given chronic exposure to nPM, a nano-sized subfraction of urban air pollution. In the cerebral cortex
Papavee Samatiwat et al.
Naunyn-Schmiedeberg's archives of pharmacology, 388(6), 601-612 (2015-02-25)
Resistance to chemotherapy is the major problem in cancer treatment. Cholangiocarcinoma (CCA) is the tumor arising from the bile duct epithelium. The disease is characterized by very poor prognosis and rarely responds to current radiotherapy or chemotherapy. Transcription factor Nrf2
Baixin Shen et al.
Urology, 84(4), 850-856 (2014-08-12)
To investigate the role and therapeutic potential of Nuclear factor erythroid-related factor 2 (Nrf2) in oxidative stress induced by di-N-butylphthalate (DBP) in testicular Leydig cells. Levels of reactive oxygen species (ROS) and Nrf2 in testicles from offspring of mice fed

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service