Skip to Content
Merck
All Photos(1)

Key Documents

EMU062291

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tmem131

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGTGGATATGCGTGTGAGGGATATGGTTTTAAAGTGGTTAACTGTCAAGAGTTTGCCCTGAGTGCCAACGCCTCCAGAGACATAGTCATATTGTTTACTCCAGATTTCACAGCCTCCAGAGTCATTCGGGAGCTGAAGTTTGTGACAAGCAGTGGCTCCGAGTTTGTGTTTGTGTTGAATGCCTCTCTTCCGTACCACATGCTAGCCGCCTGTGCAGAAGCCCTCCCTAGACCCAACTGGGAGCTCGCGCTCTACATCATCATCTCCGGGGTCATGAGTGCACTCTTTCTCCTGGTCATTGGAACAGCCTACTTGGAAGCTCAAGGGATTTGGGAGCCCTTCCGAAGGCGACTCTCCTTTGAAGCCTCAAACCCGCCCTTTGATGTTGGAAGGCCATTTGATCTC

Ensembl | mouse accession no.

ENSMUSG00000026116

NCBI accession no.

NM_018872

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... TMEM131(56030) , Tmem131(56030)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shigemi Kimura et al.
Scientific reports, 4, 5066-5066 (2014-06-12)
The ZHTc6-MyoD embryonic stem cell line expresses the myogenic transcriptional factor MyoD under the control of a tetracycline-inducible promoter. Following induction, most of the ZHTc6-MyoD cells differentiate to myotubes. However, a small fraction does not differentiate, instead forming colonies that
Yvonne Diener et al.
Scientific reports, 5, 17184-17184 (2015-11-26)
Modulation of gene expression is a useful tool to study the biology of haematopoietic stem and progenitor cells (HSPCs) and might also be instrumental to expand these cells for therapeutic approaches. Most of the studies so far have employed stable
Nicholas E Hoffman et al.
Molecular biology of the cell, 25(6), 936-947 (2014-01-17)
Emerging findings suggest that two lineages of mitochondrial Ca(2+) uptake participate during active and resting states: 1) the major eukaryotic membrane potential-dependent mitochondrial Ca(2+) uniporter and 2) the evolutionarily conserved exchangers and solute carriers, which are also involved in ion

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service