Skip to Content
Merck
All Photos(1)

Key Documents

EMU073651

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Fcgr3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TACACAGCACCAGTCCAAGCCTGTCACCATCACTGTCCAAGATCCAGCAACTACATCCTCCATCTCTCTAGTCTGGTACCACACTGCTTTCTCCCTAGTGATGTGCCTCCTGTTTGCAGTGGACACGGGCCTTTATTTCTACGTACGGAGAAATCTTCAAACCCCGAGGGAGTACTGGAGGAAGTCCCTGTCAATCAGAAAGCACCAGGCTCCTCAAGACAAGTGACACCCCATCCATCCTATGGCAAAACATACGATGTTTTGGTGGCAGCAGCAACTTTTCAGCCACACAGCCTTCCTTTGAAAGCAACTTACAAGCAGGCCGGGATGTTTGGTTCTTCAATCACAACGACTTAGGATCACCAGTTCAAGGCTTGCTGGGTCACACAGAGAGAGTGAGTGCAAGTCTAGCCTGGATAACCCAGTGAGATCCTGGG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... Fcgr3(14131)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Martina Schmittnaegel et al.
Cancer immunology research, 3(7), 764-776 (2015-02-19)
Tumor cells escape immune eradication through multiple mechanisms, including loss of antigenicity and local suppression of effector lymphocytes. To counteract these obstacles, we aimed to direct the unique cytomegalovirus (CMV)-specific immune surveillance against tumor cells. We developed a novel generation
Siva K Gandhapudi et al.
Journal of immunology (Baltimore, Md. : 1950), 194(8), 3820-3828 (2015-03-18)
Although IL-18 has not previously been shown to promote T lymphopoiesis, results obtained via a novel data mining algorithm (global microarray meta-analysis) led us to explore a predicted role for this cytokine in T cell development. IL-18 is a member
Wai W Lin et al.
Science signaling, 8(392), ra88-ra88 (2015-09-04)
Tumor necrosis factor receptor-associated factor 3 (TRAF3) is an adaptor protein that inhibits signaling by CD40 and by the receptor for B cell-activating factor (BAFF) and negatively regulates homeostatic B cell survival. Loss-of-function mutations in TRAF3 are associated with human

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service